Previous Contig 000793:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011O02Sequence499000793 (17)gb:ST35G1433_17226742e-65Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.742000793 (17)gb:ST35G1433_17226741e-84Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.
JMFF015G06Sequence631000793 (17)gb:ST35G1433_17226741e-79Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.606000793 (17)gb:ST35G1433_17226745e-45Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.
JMFF025G16Sequence631000793 (17)gb:ST35G1433_17226746e-75Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.719000793 (17)gb:ST35G1433_17226742e-90Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.
JMFF026I14Sequence631000793 (17)gb:ST35G1433_17226741e-80Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.770000793 (17)gb:ST35G1433_17226744e-89Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.
JMFF027O22Sequence580000793 (17)gb:ST35G1433_17226747e-70Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.674000793 (17)gb:ST35G1433_17226743e-51Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.
JMFF038B02Sequence600000793 (17)gb:ST35G1433_17226741e-72Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.
JMFF044F17Sequence627000793 (17)gb:ST35G1433_17226742e-79Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.317000793 (17)gb:ST35G1433_17226749e-05Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.
JMFF048G13Sequence545000793 (17)gb:ST35G1433_17226747e-73Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.503000793 (17)gb:ST35G1433_17226741e-16Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.
JMFF050L02Sequence627000793 (17)gb:ST35G1433_17226742e-79Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.465000793 (17)gb:ST35G1433_17226744e-17Solanum tuberosum mRNA for 14-3-3 protein, isolate 35G.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048G13- CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTT
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF048G13- TGGGTTTGCAAAAGATAAAAACTTTTTATTGGACTGGTTAATTGAAATAGCACCATTTTA
rJMFF050L02- GGGTTTGCAAAAGATAAAAACTTTTTATTGGACTGGTTAATTGAAATAGCACCATTTTA
rJMFF027O22- ACTTTTTATTGGACTGGTTAATTGAAATAGCACCATTTTA
                      ____________________________________________________________
consensus TGGGTTTGCAAAAGATAAAAACTTTTTATTGGACTGGTTAATTGAAATAGCACCATTTTA
 
. : . : . : . : . : . :
rJMFF048G13- GCAAACCAATACGAGATAGCCCCATTTTTGTGGACAGTATATGATACAGAAACAGATTCA
rJMFF044F17- TGATACAAAAACAAATTCA
rJMFF050L02- GCAAACCAATACGAGATAGCCCCATTTTTGTGGACAGTATATGATACAGAAACAGATTCA
rJMFF015G06- TACGAGATAGCCCCATTTTTGTGGACAGTATATGATACAGAAACAGATTCN
rJMFF027O22- GCAAACCAATACGAGATAGCCCCATTTTTGTGGACAGTATATGATACAGAAACAGATTCA
                      ____________________________________________________________
consensus GCAAACCAATACGAGATAGCCCCATTTTTGTGGACAGTATATGATACAGAAACAGATTCA
 
. : . : . : . : . : . :
rJMFF048G13- GATTCAGGCGCATAAAGATCCTAATGGCTGACTAAAACAGAGTCCAATGCTCACACTACA
rJMFF044F17- AATTCAGGCGCATAAAAATCCTAATGGCTGACTAAAACAAAGTCCAATGCTCACACCACA
rJMFF050L02- GATTCAGGCGCATAAAGATCCTAATGGCTGACTAAAACAGAGTCCAATGCTCACACCACA
rJMFF015G06- GATTCAGGCGCATAAAGATCCTAATGGCTGACTAAAACAGAGTCCAATGCTCACACCACA
rJMFF027O22- GATTCAGGCGCATAAAGATCCTAATGGCTGACTAAAACAGAGTCCAATGCTCACACTACA
rJMFF026I14- AATGGCTGACTAAAACAGAGTCCAATGCTCACACCACA
rJMFF011O02- ACCACA
                      ____________________________________________________________
consensus GATTCAGGCGCATAAAGATCCTAATGGCTGACTAAAACAGAGTCCAATGCTCACACCACA
 
. : . : . : . : . : . :
rJMFF048G13- AATGAACAGTCATCACAGGTTTCAAACTAATGTTTGAAATGACACAATTGATCATAGTTA
rJMFF044F17- AATGAACAGTCATCACAGGTTTCAAACTAATGTTTGAAATGACACAATTGATCATAGTTA
rJMFF050L02- AATGAACAGTCATCACAGGTTTCAAACTAATGTTTGAAATGACACAATTGATCATAGTTA
rJMFF015G06- AATGAACAGTCATCACAGGTTTCAAACTAATGTTTGAAATGACACAATTGATCATAGTTA
rJMFF027O22- AATGAACAGTCATCACAGGTTTCAAACTAATGTTTGAAATGACACAATTGATCATAGTTA
rJMFF026I14- AATGAACAGTCATCACAGGTTTCAAACTAATGTTTGAAATGACACAATTGATCATAGTTA
rJMFF011O02- AATGAACAGTCATCACAGGTTTCAAACTAATGTTTGAAATGACACAATTGATCATAGTTA
rJMFF025G16- AGGTTTCAAACTAATGTTTGAAATGACACAATTGATCATAGTTA
                      ____________________________________________________________
consensus AATGAACAGTCATCACAGGTTTCAAACTAATGTTTGAAATGACACAATTGATCATAGTTA
 
. : . : . : . : . : . :
rJMFF048G13- AGCAATATGATATATATAATACAAGAGCCATCATCATGAGTCATAATACTTGCAGATTAA
rJMFF044F17- AGCAATATGATATATATAATACAAGAGCCATCATCATGAGTCATAATACTTGCAAATTAA
rJMFF050L02- AGCAATATGATATATATAATACAAGAGCCATCATCATGAGTCATAATACTTGCAGATTAA
rJMFF015G06- AGCAATATGATATATATAATACAAGAGCCATCATCATGAGTCATAATACTTGCAGATTAA
rJMFF027O22- AGCAATATGATATATATAATACAAGAGCCATCATCATGAGTCATAATACTTGCAGATTAA
rJMFF026I14- AGCAATATGATATATATAATACAAGAGCCATCATCATGAGTCATAATACTTGCAGATTAA
rJMFF011O02- AGCAATATGATATATATAATACAAGAGCCATCATCATGAGTCATAATACTTGCAGATTAA
rJMFF025G16- AGCAATATGATATATATAATACAAGAGCCATCATCATGAGTCATAATACTTGCAGATTAA
                      ____________________________________________________________
consensus AGCAATATGATATATATAATACAAGAGCCATCATCATGAGTCATAATACTTGCAGATTAA
 
. : . : . : . : . : . :
rJMFF048G13- AGATGGAGACGAGAGGGGAAGTTTCAACTCAAGCTTCATCCATCTGATCCTGAATATCCG
rJMFF044F17- AGATGGAAACGAAAGGGGAAGTTTCAACTCAAGCTTCATCCATCTGATCCTGAATATCCG
rJMFF050L02- AGATGGAGACGAGAGGGGAAGTTTCAACTCAAGCTTCATCCATCTGATCCTGAATATCCG
rJMFF015G06- AGATGGAGACGAGAGGGGAAGTTTCAACTCAAGCTTCATCCATCTGATCCTGAATATCCG
rJMFF027O22- AGATGGAGACGAGAGGGGAAGTTTCAACTCAAGCTTCATCCATCTGATCCTGAATATCCG
rJMFF026I14- AGATGGAGAAGAGAGGGGAAGTTTCAACTCAAGCTTCATCCATCTGATCCTGAATATCCG
rJMFF011O02- AGATGGAGACGAGAGGGGAAGTTTCAACTCAAGCTTCATCCATCTGATCCTGAATATCCG
rJMFF025G16- AGATGGAGACGAGAGGGGAAGTTTCAACTCAAGCTTCATCCATCTGATCCTGAATATCCG
                      ____________________________________________________________
consensus AGATGGAGACGAGAGGGGAAGTTTCAACTCAAGCTTCATCCATCTGATCCTGAATATCCG
 
. : . : . : . : . : . :
rJMFF048G13- AAGTCCAAAGAGTGAGGTTATCCCTCAACAGTTGCATGATCAGAGTGCTGTCCTTGTAGG
rJMFF044F17- AAGTCCAAAAAGTGAGGTTATCCCTCAACAGTTGCATGATCA
rJMFF050L02- AAGTCCAAAGAGTGAGGTTATCCCTCAACAGTTGCATGATCAGAGTGCTGTCCTTGTAGG
rJMFF015G06- AAGTCCAAAGAGTGAGGTTATCCCTCAACAGTTGCATGATCANAGTGCTGTCCTTGTANG
rJMFF027O22- AAGTCCAAAGAGTGAGGTTATCCCTCAACAGTTGCATGATCAGAGTGCTGTCCTTGTAGG
rJMFF026I14- AAGTCCAAAGAGTGAGGTTATCCCTCAACAGTTGCATGATCAGAGTGCTGTCCTTGTAGG
rJMFF011O02- AAGTCCAAAGAGTGAGGTTATCCCTCAACAGTTGCATGATCAGAGTGCTGTCCTTGTAGG
rJMFF025G16- AAGTCCAAAGAGTGAGGTTATCCCTCAACAGTTGCATGATCAGAGTGCTGTCCTTGTAGG
                      ____________________________________________________________
consensus AAGTCCAAAGAGTGAGGTTATCCCTCAACAGTTGCATGATCAGAGTGCTGTCCTTGTAGG
 
. : . : . : . : . : . :
rJMFF048G13- ACTCCTCGCCCAATGTGTCCAGCTCAGCAATAGCTTCCTCGAA
rJMFF050L02- ACTCCTCGCCCAATGTGTCCAGCTCAGCAATAGCTTCCTCGAATGC
rJMFF015G06- ACTCCTCGCCCAATGTGTCCAGCTCAGCAATAGCTTCCTCGAATGCCTGTTTAGCCATAC
rJMFF027O22- ACTCCTCGCCCAATGTGTCCAGCTCAGCAATAGCTTCCTCGAATGCCTGTTTAGCCATAC
rJMFF026I14- ACTCCTCGCCCAATGTGTCCAGCTCAGCAATAGCTTCCTCGAATGCCTGTTTAGCCATAC
rJMFF011O02- ACTCCTCGCCCAATGTGTCCAGCTCAGCAATAGCTTCCTCGAATGCCTGTTTAGCCATAC
rJMFF025G16- ACTCCTCGCCCAATGTGTCCAGCTCAGCAATAGCTTCCTCGAATGCCTGTTTAGCCATAC
                      ____________________________________________________________
consensus ACTCCTCGCCCAATGTGTCCAGCTCAGCAATAGCTTCCTCGAATGCCTGTTTAGCCATAC
 
. : . : . : . : . : . :
rJMFF015G06- TACATGCTTTTTCTGATGCATTCAAAATCTCATAGTANAATACCGAGAAGTTGAGTGCCA
rJMFF027O22- TACATGCTTTTTCTGATGCATTCAAAATCTCATAGTAGAATACCGAGAAGTTGAGTGCCA
rJMFF026I14- TACATGCTTTTTCTGATGCATTCAAAATCTCATAGTAGAATACCGAGAAGTTGAGTGCCA
rJMFF011O02- TACATGCTTTTTCTGATGCATTCAAAATCTCATAGTAGAATACCGAGAAGTTGAGTGCCA
rJMFF025G16- TACATGCTTTTTCTGATGCATTCAAAATCTCATAGTAGAATACCGAGAAGTTGAGTGCCA
JMFF025G16+ ATCTCATAGTAGAATACCGAGAAGTTGAGTGCCA
JMFF050L02+ CATAGTAGAATACCGAGAAGTNGAGTGCCA
JMFF044F17+ CATAGTAGAATACCGAGAAGTTGAGTGCCA
JMFF026I14+ ATCTCATAGTAGAATACCGAGAAGTTGAGTGCCA
JMFF038B02+ CA
JMFF015G06+ TCTCATAGTAGAATNCCGAGAAGTTGAGTGCCA
                      ____________________________________________________________
consensus TACATGCTTTTTCTGATGCATTCAAAATCTCATAGTAGAATACCGAGAAGTTGAGTGCCA
 
. : . : . : . : . : . :
rJMFF015G06- AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
rJMFF027O22- AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
rJMFF026I14- AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
rJMFF011O02- AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
rJMFF025G16- AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
JMFF025G16+ AGCCCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
JMFF050L02+ AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
JMFF044F17+ AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
JMFF048G13+ AGCAGCT
JMFF027O22+ TGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
JMFF026I14+ AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
JMFF038B02+ AG-CCCAATNGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCNTGAGCAGCT
JMFF015G06+ AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
                      ____________________________________________________________
consensus AG-CCCAATCGTATAGGATGTGTAGGGGCAAGATCTGCAGCCGCAATGTCCTGAGCAGCT
 
. : . : . : . : . : . :
rJMFF015G06- TTATAGGCTAGCATAGTCACCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
rJMFF027O22- TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
rJMFF026I14- TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
rJMFF011O02- TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
rJMFF025G16- TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
JMFF025G16+ TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
JMFF050L02+ TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
JMFF044F17+ TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
JMFF048G13+ TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
JMFF027O22+ TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
JMFF011O02+ CTCATTCCCAATCTTAAACTCA
JMFF026I14+ TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
JMFF038B02+ TTATAGGCTAGCATAGTCACCTCAGCAGCCTCTTTGCGCTCATTCCCAATNTTAAACTCA
JMFF015G06+ TTATAGGCTAGCATAGTCACCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
                      ____________________________________________________________
consensus TTATAGGCTAGCATAGTCTCCTCAGCAGCCTCTTTGCGCTCATTCCCAATCTTAAACTCA
 
. : . : . : . : . : . :
rJMFF015G06- GCCAAATAGCGATGGT
rJMFF027O22- GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAA
rJMFF026I14- GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
rJMFF011O02- GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
rJMFF025G16- GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
JMFF025G16+ GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
JMFF050L02+ GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
JMFF044F17+ GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
JMFF048G13+ GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
JMFF027O22+ GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
JMFF011O02+ GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
JMFF026I14+ GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
JMFF038B02+ GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
JMFF015G06+ GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
                      ____________________________________________________________
consensus GCCAAATAGCGATGGTAATCGCCCTTCATCTTCAAGTAGAAGACTTTGGATTCGGGAGCT
 
. : . : . : . : . : . :
rJMFF026I14- GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
rJMFF011O02- GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
rJMFF025G16- GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
JMFF025G16+ GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
JMFF050L02+ GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
JMFF044F17+ GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
JMFF048G13+ GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
JMFF027O22+ GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
JMFF011O02+ GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
JMFF026I14+ GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
JMFF038B02+ GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
JMFF015G06+ GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
                      ____________________________________________________________
consensus GAAGCGGAGGGTATCAAATACTGGTCGAGGAGCTTGAGAATTCCGGCACAGACGGCGGAA
 
. : . : . : . : . : . :
rJMFF026I14- AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-AGACGACGTGGTCGTCGTTCTT
rJMFF011O02- AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGAGGGACGACGTGGTCGTCGTTCTT
rJMFF025G16- AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
JMFF025G16+ AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
JMFF050L02+ AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
JMFF044F17+ AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
JMFF048G13+ AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
JMFF027O22+ AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
JMFF011O02+ AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
JMFF026I14+ AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
JMFF038B02+ AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
JMFF015G06+ AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
                      ____________________________________________________________
consensus AGCTCGGACTCAACCTTGGATCTGTAGTCCTTGACGA-GGACGACGTGGTCGTCGTTCTT
 
. : . : . : . : . : . :
rJMFF026I14- GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
rJMFF011O02- GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
rJMFF025G16- GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
JMFF025G16+ GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
JMFF050L02+ GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
JMFF044F17+ GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
JMFF048G13+ GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
JMFF027O22+ GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
JMFF011O02+ GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
JMFF026I14+ GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
JMFF038B02+ GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
JMFF015G06+ GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
                      ____________________________________________________________
consensus GCGGCCCTCCTCCTTCTGCTCAATCGACGAAACTATCCGCCAAGCCGCCCGCTGAGAGCC
 
. : . : . : . : . : . :
rJMFF026I14- GATAACGTTCTTGT
rJMFF011O02- GATAACGTTCTTGTA
rJMFF025G16- GATAACGTTCTTGTAGG
JMFF025G16+ GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
JMFF050L02+ GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
JMFF044F17+ GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
JMFF048G13+ GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
JMFF027O22+ GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
JMFF011O02+ GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
JMFF026I14+ GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
JMFF038B02+ GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
JMFF015G06+ GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
                      ____________________________________________________________
consensus GATAACGTTCTTGTAGGCAACCGAGAGAAGGTTGCGCTCCTCCACGGTGAGCTCGAAGCC
 
. : . : . : . : . : . :
JMFF025G16+ GGAGGTAGCGGAGCTGATCACCAGGCCGTCCATGAACTTCGCCATCTCCTCGTACCGCTC
JMFF050L02+ GGAGGTAGCGGAGCTGATCACCAGGCCGTCCATGAACTTCGCCATCTCCTCGTACCGCTC
JMFF044F17+ GGAGGTAGCGGAGCTGATCACCAGGCCGTCCGTGAACTTCGCCATCTCCTCGTACCGCTC
JMFF048G13+ GGAGGTAGCGGAGCTGATCACCAGGCCGTCCATGAACCTCGCCATCTCCTCGTACCGCTC
JMFF027O22+ GGAGGTAGCGGAGCTGATCACCAGGCCGTCCATGAACCTCGCCATCTCCTCGTACCGCTC
JMFF011O02+ GGAGGTAGCGGAGCTGATCACCAGGCCGTCCATGAACTTCGCCATCTCCTCGTACCGCTC
JMFF026I14+ GGAGGTAGCGGAGCTGATCACCAGGCCGTCCATGAACTTCGCCATCTCCTCGTACCGCTC
JMFF038B02+ GGAGGTAGCGGAGCTGATCACCAGGCCGTCCATGAACTTCGCCATCTCCTCGTACCGCTC
JMFF015G06+ GGAGGTAGCGGAGCTGATCACCAGGCCGTCCATGAACTTCGCCATCTCCTCGTACCGCTC
                      ____________________________________________________________
consensus GGAGGTAGCGGAGCTGATCACCAGGCCGTCCATGAACTTCGCCATCTCCTCGTACCGCTC
 
. : . : . : . : . : . :
JMFF025G16+ CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
JMFF050L02+ CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
JMFF044F17+ CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
JMFF048G13+ CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
JMFF027O22+ CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
JMFF011O02+ CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
JMFF026I14+ CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
JMFF038B02+ CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
JMFF015G06+ CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
                      ____________________________________________________________
consensus CGCTTGCTCCGCCAGCTTAGCCATGTACACGCTCTGCTCCCGGCTTAGATTTCCCGGCAT
 
. : . : . : . : . : . :
JMFF025G16+ CGCCATTCCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTT
JMFF050L02+ CGCCATTCCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTTT
JMFF044F17+ CGCCATTCCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTTT
JMFF048G13+ CGCCATTCCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTTT
JMFF027O22+ CGCCATTCCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTTT
JMFF011O02+ CGCCATTCCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTT
JMFF026I14+ CGCCATTCCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTTT
JMFF038B02+ CGCCATTTCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTTT
JMFF015G06+ CGCCATTTCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTTTT
                      ____________________________________________________________
consensus CGCCATTCCCGTCTCGGTCGCCGTCTTTTTTACTCTTTAAAATTAAACGAGTAAATTTTT