Previous Contig 000789:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015C09Sequence574000780 (2)gb:AB024029_15157390.002Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.714000789 (4)gb:AB024029_15157395e-08Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.
JMFF015F08Sequence542000789 (4)gb:AB024029_15157392e-08Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.505000789 (4)gb:AB024029_15157391e-08Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.
JMFF029E02Sequence483000780 (2)gb:AB024029_15157390.002Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.589000789 (4)gb:AB024029_15157393e-08Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L19.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF015C09+ TTCACGGATGAAGCTAACATTGACGTTGTAG
                      ____________________________________________________________
consensus TTCACGGATGAAGCTAACATTGACGTTGTAG
 
. : . : . : . : . : . :
rJMFF015C09+ TGGAAGAGGGGGATGATAAAGACGATGACTTAGTGCAAAAAGATGAAAATATTGATAAGC
                      ____________________________________________________________
consensus TGGAAGAGGGGGATGATAAAGACGATGACTTAGTGCAAAAAGATGAAAATATTGATAAGC
 
. : . : . : . : . : . :
rJMFF029E02+ TCTGTGGTTGAAGCAGGAGGTTCAGAGCACA
rJMFF015C09+ CTATGGGTAGAAGTGAAAATTGTGAGAGTTCTGTGGTTGAAGCAGGAGGTTCAGAGCACA
                      ____________________________________________________________
consensus CTATGGGTAGAAGTGAAAATTGTGAGAGTTCTGTGGTTGAAGCAGGAGGTTCAGAGCACA
 
. : . : . : . : . : . :
rJMFF029E02+ TGATTCCGGGGGTGTCAATTCCAGGTGTTTCAGGAGTCCCAGAGACTTGTGGCGGCAGGG
rJMFF015C09+ TGATTCCGGGGGTGTCAATTCCAGGTGTTTCAGGAGTCCCAGAGACTTGTGGCGACAGGG
rJMFF015F08+ GG
JMFF015F08- GG
                      ____________________________________________________________
consensus TGATTCCGGGGGTGTCAATTCCAGGTGTTTCAGGAGTCCCAGAGACTTGTGGCGGCAGGG
 
. : . : . : . : . : . :
rJMFF029E02+ CTGTGGATGAGGAATGGGATAGTGACAGTGACGATGATGATTTGCGCATTGTGTTGAATG
rJMFF015C09+ CTGTGGATGAGGAATGGGATAGTGACAGTGACGATGATGATTTGCGCATTGTGTTGAATG
rJMFF015F08+ CTATGGATGAGGAATGGGATAGTGACAGTGACGATGATGATTTGCGCATTGTGTTGAATG
JMFF015F08- CTATGGATGAGGAATGGGATAGTGACAGTGACGATGATGATTTGCGCATTGTGTTGAATG
                      ____________________________________________________________
consensus CTATGGATGAGGAATGGGATAGTGACAGTGACGATGATGATTTGCGCATTGTGTTGAATG
 
. : . : . : . : . : . :
rJMFF029E02+ ACAACAATCATGGACCTATGGGAATGGACAGAATGGGAGGTGATGGTGATGATGACGATG
rJMFF015C09+ ACAACAATCATGGACCTATGGGAATGGACAGAATGGGAGGTGATGGTGATGATGACGATG
rJMFF015F08+ ACAACAATCATGGACCTATGGGAATGGACAGAATGGGAGGTGATGGTGATGATGACGATG
JMFF015F08- ACAACAATCATGGACCTATGGGAATGGACAGAATGGGAGGTGATGGTGATGATGACGATG
                      ____________________________________________________________
consensus ACAACAATCATGGACCTATGGGAATGGACAGAATGGGAGGTGATGGTGATGATGACGATG
 
. : . : . : . : . : . :
rJMFF029E02+ ATGATGGGGACCCTTTGGTTATTGTAGCTAACAGTGATGATCCTAGTCATCAACCAATGG
rJMFF015C09+ ATGATGGGGACCCTTTGGTTATTGTAGCTAACAGTGATGATCCTAGTCATCAACCAATGG
rJMFF015F08+ ATGATGGGGACCCTTTGGTTATTGTAGCTAACAGTGATGATCCTAGTCATCAACCAATGG
JMFF015F08- ATGATGGGGACCCTTTGGTTATTGTAGCTAACAGTGATGATCCTAGTCATCAACCAATGG
                      ____________________________________________________________
consensus ATGATGGGGACCCTTTGGTTATTGTAGCTAACAGTGATGATCCTAGTCATCAACCAATGG
 
. : . : . : . : . : . :
rJMFF029E02+ TGGAGGAGCAAGAATGGGGTGATGAGCTGGGCAATTCTGCCGATGGGGAGAGGAAGGAGG
rJMFF015C09+ TGGAGGAGCAAGAATGGGGTGATGAGCTGGGCAATTCTGCCGATGGGGAGAGGAAGGAGG
rJMFF015F08+ TGGAGGAGCAAGAATGGGGTGATGAGCTGGGCAATTCTGCCGATGGGGAGAGGAAGGAGG
JMFF015F08- TGGAGGAGCAAGAATGGGGTGATGAGCTGGGCAATTCTGCCGATGGGGAGAGGAAGGAGG
                      ____________________________________________________________
consensus TGGAGGAGCAAGAATGGGGTGATGAGCTGGGCAATTCTGCCGATGGGGAGAGGAAGGAGG
 
. : . : . : . : . : . :
rJMFF029E02+ ATGCTACAAAAGTGAATGTTGGACCAGGATATGCGCCAAAGATTGGGTACAGCAATCATG
rJMFF015C09+ ATGCTACAAAAGTGAATGTTGGACCAGGATATGCGCCAAAGATTGGGTACAGCAATCATG
rJMFF015F08+ ATGCTGCAAAAGTGAATGTTGGACCAGGATATGCGCCAAAGATTGGGTACAGCAATCATG
JMFF015F08- ATGCTGCAAAAGTGAATGTTGGACCAGGATATGCGCCAAAGATTGGGTACAGCAATCATG
                      ____________________________________________________________
consensus ATGCTGCAAAAGTGAATGTTGGACCAGGATATGCGCCAAAGATTGGGTACAGCAATCATG
 
. : . : . : . : . : . :
rJMFF029E02+ GGTACCACCATCCATATCATTCACAGTTTAAGGTCAGTCGTGACGTTGACACCTGGGGTT
rJMFF015C09+ GGTACCACCATCCATATCATTCACAGTTTAAGGTCAGTCGTGACGTTGACACCTGGGGTT
rJMFF015F08+ GGTACCACCATCCATATCATTCACAGTTTAAGGTCAGTCGTGACGTTGACACCTGGGGTT
JMFF015F08- GGTACCACCATCCATATCATTCACAGTTTAAGGTCAGTCGTGACGTTGACACCTGGGGTT
                      ____________________________________________________________
consensus GGTACCACCATCCATATCATTCACAGTTTAAGGTCAGTCGTGACGTTGACACCTGGGGTT
 
. : . : . : . : . : . :
rJMFF029E02+ TGTGCTTCCTCATCTTGTTTGATCAGACTATGAAATGTAAATTGACTTATAGTTGTCATG
rJMFF015C09+ TGTGCTTCCTCATCTTGTTTGATCAGACTATGAAATGTAAATTGACTTATAGTTGTCATG
rJMFF015F08+ TGTGCTTCCTCATCTTGTTTGATCAGACTATGAAATGTAAATTGACTTATAGTTGTCATG
JMFF015F08- TGTGCTTCCTCATCTTGTTTGATCAGACTATGAAATGTAAATTGACTTATAGTTGTCATG
                      ____________________________________________________________
consensus TGTGCTTCCTCATCTTGTTTGATCAGACTATGAAATGTAAATTGACTTATAGTTGTCATG
 
. : . : . : . : . : . :
rJMFF029E02+ TGATGTGGAACTAGTGATTATAAACTGGTCAGAATTGTTGAATGCACTCGTAAAATGGAT
rJMFF015C09+ TGATGTGGAACTAGTGATTATAAACTGGTCAGAATTGTTGAATGCACTCGTAAAATGGAT
rJMFF015F08+ TGATGTGGAACTAGTGATTATAAACTGGTCAGAATTGTTGAATGCACTCGTAAAATGGAT
JMFF015F08- TGATGTGGAACTAGTGATTATAAACTGGTCAGAATTGTTGAATGCACTCGTAAAATGGAT
                      ____________________________________________________________
consensus TGATGTGGAACTAGTGATTATAAACTGGTCAGAATTGTTGAATGCACTCGTAAAATGGAT
 
. : . : . : . : . : . :
rJMFF029E02+ AGTTGTACTGATTTTGAT
rJMFF015C09+ AGTTGTACTGATTTTGAT
rJMFF015F08+ AGTTGTACTGATTTTGAT
JMFF015F08- AGTTGTACTGATTTTGATATTAATGAAATTGTCTTCTTTTTTTGCTTTCCAAAAAAAAAA
                      ____________________________________________________________
consensus AGTTGTACTGATTTTGATATTAATGAAATTGTCTTCTTTTTTTGCTTTCCAAAAAAAAAA