Previous Contig 000786:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015E16Sequence617000786 (2)gb:AX647483_14723670.003Sequence 1675 from Patent EP1270724.717010868 (2)gb:BC083009_25630332e-07Xenopus laevis hypothetical LOC494838, mRNA (cDNA clone MGC:98826 IMAGE:3401380)
JMFF049A14Sequence641000786 (2)gb:AX647483_14723670.003Sequence 1675 from Patent EP1270724.156010868 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049A14+ CTGTAAATGTCACAGGCTTCTCCGGGATATTATATGTGGGA
JMFF015E16+ GGATATTATATGTGGGA
                      ____________________________________________________________
consensus CTGTAAATGTCACAGGCTTCTCCGGGATATTATATGTGGGA
 
. : . : . : . : . : . :
JMFF049A14+ GCATCAAAGGGATCATCAACGGTAGATACCTCTTTTCGGCCCTCTGATCGCTTTTGTCCA
JMFF015E16+ GCATCAAAGGGATCATCAACGGTAGATACCTCTTTTCGGCCCTCTGATCGCTTTTGTCCA
                      ____________________________________________________________
consensus GCATCAAAGGGATCATCAACGGTAGATACCTCTTTTCGGCCCTCTGATCGCTTTTGTCCA
 
. : . : . : . : . : . :
JMFF049A14+ GTTGATTCAGAAGCCTTTGATGCAAATGTTCTAGCAAAGCAAGGCATCTTGAATTTTATA
JMFF015E16+ GTTGATTCAGAAGCCTTTGATGCAAATGTTCTAGCAAAGCAAGGCATCTTGAATTTTATA
                      ____________________________________________________________
consensus GTTGATTCAGAAGCCTTTGATGCAAATGTTCTAGCAAAGCAAGGCATCTTGAATTTTATA
 
. : . : . : . : . : . :
JMFF049A14+ CCATTGATATTGGCAACCTGAAATGGTGCCTGAAAAGTCGTTACGTGTTTCATATTTGGA
JMFF015E16+ CCATTGATATTGGCAACCTGAAATGGTGCCTGAAAAGTCGTTACGTGTTTCATATTTGGA
                      ____________________________________________________________
consensus CCATTGATATTGGCAACCTGAAATGGTGCCTGAAAAGTCGTTACGTGTTTCATATTTGGA
 
. : . : . : . : . : . :
JMFF049A14+ CGGTCTCTGAATAGTAAAGGAAGTCCATCACCTTTGTTCATAACCCTAGCTATGGGATTA
JMFF015E16+ CGGTCTCTGAATAGTAAAGGAAGTCCATCACCTTTGTTCATAACCCTAGCTATGGGATTA
                      ____________________________________________________________
consensus CGGTCTCTGAATAGTAAAGGAAGTCCATCACCTTTGTTCATAACCCTAGCTATGGGATTA
 
. : . : . : . : . : . :
JMFF049A14+ GCAAGGATAGAAGATTTGCTTGCATAAGCTGATTCTGCTAATTCCCTCCTTACAAAAGGA
JMFF015E16+ GCAAGGATAGAAGATTTGCTTGCATAAGCTGATTCTGCTAATTCCCTCCTTACAAAAGGA
                      ____________________________________________________________
consensus GCAAGGATAGAAGATTTGCTTGCATAAGCTGATTCTGCTAATTCCCTCCTTACAAAAGGA
 
. : . : . : . : . : . :
JMFF049A14+ TTCGCGGCAGCATTTTCCGATACCAGAGAAGAAAACCCACAAATACCCACATCAGAAACA
JMFF015E16+ TTCGCGGCAGCATTTTCCGATACCAGAGAAGAAAACCCACAAATACCCACATCAGAAACA
                      ____________________________________________________________
consensus TTCGCGGCAGCATTTTCCGATACCAGAGAAGAAAACCCACAAATACCCACATCAGAAACA
 
. : . : . : . : . : . :
JMFF049A14+ CTCTTGGTAGGCGCGTTCTCGAAGAAAGCATTCGAGTTATTGTGTGATTTTAAGGCACAT
JMFF015E16+ CTCTTGGTAGGCGCGTTCTCGAAGAAAGCATTCGAGTTATTGTGTGATTTTAAGGCACAT
                      ____________________________________________________________
consensus CTCTTGGTAGGCGCGTTCTCGAAGAAAGCATTCGAGTTATTGTGTGATTTTAAGGCACAT
 
. : . : . : . : . : . :
JMFF049A14+ ATGAATCTGTTAATAGATAACCTGCTTCTCCGTACACTTTGCAGCATCTTCCCACCCGCA
JMFF015E16+ ATGAATCTGTTAATAGATAACCTGCTTCTCCGTACACTTTGCAGCATCTTCCCACCCGCA
                      ____________________________________________________________
consensus ATGAATCTGTTAATAGATAACCTGCTTCTCCGTACACTTTGCAGCATCTTCCCACCCGCA
 
. : . : . : . : . : . :
JMFF049A14+ CTGTGCACTTTGCTGAGATTTTTGATCTTGATCGAGCCAGTCAAAATCACAAGAGCTGAT
JMFF015E16+ CTGTGCACTTTGCTGAGATTTTTGATCTTGATCGAGCCAGTCAAAATCACAAGAGCTGAT
                      ____________________________________________________________
consensus CTGTGCACTTTGCTGAGATTTTTGATCTTGATCGAGCCAGTCAAAATCACAAGAGCTGAT
 
. : . : . : . : . : . :
JMFF049A14+ TAAGAGCAAAAAAGATCGAATCCTTGAAGACGCTATTAAGCTAATTTTTCTCAGAAGAAC
JMFF015E16+ TAAGAGCAAAAAAGATCGAATCCTTGAAGACGCTATTAAGCTAATTTTTCTCAGAAGAAC
                      ____________________________________________________________
consensus TAAGAGCAAAAAAGATCGAATCCTTGAAGACGCTATTAAGCTAATTTTTCTCAGAAGAAC