Previous Contig 000779:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015C03Sequence542000779 (2)gb:AK176922_18189101e-53Arabidopsis thaliana mRNA for prolyl carboxypeptidase like protein, complete cds
JMSF043C04Sequence767000779 (2)gb:AK176922_18189108e-90Arabidopsis thaliana mRNA for prolyl carboxypeptidase like protein, complete cds763024016gb:AK176216_18182041e-69Arabidopsis thaliana mRNA for prolyl carboxypeptidase like protein, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043C04+ TTAGATGCAAGTTTCTTGTCAACG
                      ____________________________________________________________
consensus TTAGATGCAAGTTTCTTGTCAACG
 
. : . : . : . : . : . :
JMSF043C04+ AGTTGAGTAATTTCTTGCAGTGCACTTTTACATTCAGGGCCTGCAGATTCCCCAACCTGC
                      ____________________________________________________________
consensus AGTTGAGTAATTTCTTGCAGTGCACTTTTACATTCAGGGCCTGCAGATTCCCCAACCTGC
 
. : . : . : . : . : . :
JMSF043C04+ TCATCAAATTCCGTGAAGTTGAATATAGAAAGAACAACTCCAGAACTTGCAAGACTTCCA
                      ____________________________________________________________
consensus TCATCAAATTCCGTGAAGTTGAATATAGAAAGAACAACTCCAGAACTTGCAAGACTTCCA
 
. : . : . : . : . : . :
JMSF043C04+ CATGTTAGATGAGGGAACTTCAATCGAAACCAGGCACTAAGGGCTCCAGCATATGAAGTG
                      ____________________________________________________________
consensus CATGTTAGATGAGGGAACTTCAATCGAAACCAGGCACTAAGGGCTCCAGCATATGAAGTG
 
. : . : . : . : . : . :
JMSF043C04+ CCAAAGACAAACCATGGATTATCAGCATTAGATTTATTGAGCTTAGCATTCAAGGTTTCC
JMFF015C03+ CC
                      ____________________________________________________________
consensus CCAAAGACAAACCATGGATTATCAGCATTAGATTTATTGAGCTTAGCATTCAAGGTTTCC
 
. : . : . : . : . : . :
JMSF043C04+ TGATAATATTGACGGAAAGCAGCAAGGTCAAAAAGTGCCTGCTTTGATGAAAGATATTTC
JMFF015C03+ TGATAATATTGACGGAAAGCAGCAAGGTCAAAAAGTGCCTGCTTTGATGAAAGATATTTC
                      ____________________________________________________________
consensus TGATAATATTGACGGAAAGCAGCAAGGTCAAAAAGTGCCTGCTTTGATGAAAGATATTTC
 
. : . : . : . : . : . :
JMSF043C04+ AGGTTCTCTGTGGTCAAAGATTTAAATGGTGAACTCTTGCCATAATACCGATGCTCAACA
JMFF015C03+ AGGTTCTCTGTGGTCAAAGATTTAAATGGTGAACTCTTGCCATAATACCGATGCTCAACA
                      ____________________________________________________________
consensus AGGTTCTCTGTGGTCAAAGATTTAAATGGTGAACTCTTGCCATAATACCGATGCTCAACA
 
. : . : . : . : . : . :
JMSF043C04+ GAAACAACAGCAGCTCCAAACTTCTTAGCCAAAACACTGATGTAGTCATTAGGTATCCCA
JMFF015C03+ GAAACAACAGCAGCTCCAAACTTCTTAGCCAAAACACTGATGTAGTCATTAGGTATCCCA
                      ____________________________________________________________
consensus GAAACAACAGCAGCTCCAAACTTCTTAGCCAAAACACTGATGTAGTCATTAGGTATCCCA
 
. : . : . : . : . : . :
JMSF043C04+ TTACAAGAAGCTTCCCCGCATATTTTCAAAAATATTGGTCCATCAGGAATGCGGAAGTGG
JMFF015C03+ TTACAAGAAGCTTCCCCGCATATTTTCAAAAATATTGGTCCATCAGGAATGCGGAAGTGG
                      ____________________________________________________________
consensus TTACAAGAAGCTTCCCCGCATATTTTCAAAAATATTGGTCCATCAGGAATGCGGAAGTGG
 
. : . : . : . : . : . :
JMSF043C04+ TCAAGAAACTCATAATATCGTTGGCTGAATTTACGATGGTCATAAGGAGAGAAATGATCG
JMFF015C03+ TCAAGAAACTCATAATATCGTTGGCTGAATTTACGATGGTCATAAGGAGAGAAATGATCG
                      ____________________________________________________________
consensus TCAAGAAACTCATAATATCGTTGGCTGAATTTACGATGGTCATAAGGAGAGAAATGATCG
 
. : . : . : . : . : . :
JMSF043C04+ AGAGTTTGATTGAGCCAGAGTTCATCCTGGGTCAAATACTTGCTGCTTTCCGCAGAGGAT
JMFF015C03+ AGAGTTTGATTGAGCCAGAGTTCATCCTGGGTCAAATACTTGCTGCTTTCCGCAGAGGAT
                      ____________________________________________________________
consensus AGAGTTTGATTGAGCCAGAGTTCATCCTGGGTCAAATACTTGCTGCTTTCCGCAGAGGAT
 
. : . : . : . : . : . :
JMSF043C04+ AGCTGGAGAAGACTGGACACTACGACGCCGTTTGAAGTTGCCAGAAATGACAGGAAGAAG
JMFF015C03+ AGCTGGNGAAGACTGGACACTACGACGCCGTTTGAAGTTGCCAGAANTGACAGGAAGAAG
                      ____________________________________________________________
consensus AGCTGGAGAAGACTGGACACTACGACGCCGTTTGAAGTTGCCAGAAATGACAGGAAGAAG
 
. : . : . : . : . : . :
JMSF043C04+ AAGACGAAGAAGAAACATGCAGTCAGCTTCATGTTGATCTGATTATCGTCCCTCTTCTTA
JMFF015C03+ AAGACGAAGAAGAAACATGCAGTCAGCTTCATGTTGATCTGATTATCGTCCCTCTTCTTA
                      ____________________________________________________________
consensus AAGACGAAGAAGAAACATGCAGTCAGCTTCATGTTGATCTGATTATCGTCCCTCTTCTTA
 
. : . : . : . : . : . :
JMSF043C04+ AGCCACTCAAATCGCAGTGCTT
JMFF015C03+ AGCCACTCAAATCGCAGTGCTTATGATCCTTTTTCTTGTCACAGGCCAATATGTATAGTC
                      ____________________________________________________________
consensus AGCCACTCAAATCGCAGTGCTTATGATCCTTTTTCTTGTCACAGGCCAATATGTATAGTC