Previous Contig 000778:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015B23Sequence488000778 (3)pir|JC4817|JC48175e-36RNA-binding protein RZ-1 - wood tobacco>gb:TOBRBPRZ1_1725528 Tobacco DNA for RNA756000778 (3)gb:AC092557_17354781e-17Oryza sativa chromosome 3 BAC OSJNBa0096I06 genomic sequence, complete sequence.
JMSF011J22Sequence272000778 (3)pir|JC4817|JC48173e-21RNA-binding protein RZ-1 - wood tobacco>gb:TOBRBPRZ1_1725528 Tobacco DNA for RNA701022437

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF015B23- CTCACGAAAGCGAAT
                      ____________________________________________________________
consensus CTCACGAAAGCGAAT
 
. : . : . : . : . : . :
rJMFF015B23- AACGAGCAGCGATTGTAGCATTCAAAAGACTGAGACCACATTCAAATGTGCAAATTAAGC
                      ____________________________________________________________
consensus AACGAGCAGCGATTGTAGCATTCAAAAGACTGAGACCACATTCAAATGTGCAAATTAAGC
 
. : . : . : . : . : . :
rJMFF015B23- AAGCATAAGATCCCAATCAAACCATACTATCGAACAATTTACGGGACATAGAAGAGTAGA
                      ____________________________________________________________
consensus AAGCATAAGATCCCAATCAAACCATACTATCGAACAATTTACGGGACATAGAAGAGTAGA
 
. : . : . : . : . : . :
rJMFF015B23- TTATTAGTGTCATGTTTCATAAGTTCAAAAGATTGATCGACGATTCAGACATGCCAAGAA
                      ____________________________________________________________
consensus TTATTAGTGTCATGTTTCATAAGTTCAAAAGATTGATCGACGATTCAGACATGCCAAGAA
 
. : . : . : . : . : . :
rJMFF015B23- GCAGCCCTCCATGATAACATCCAGTTGCAGTAGCATTTCCAACTCTTAATCAGCTCGAGA
                      ____________________________________________________________
consensus GCAGCCCTCCATGATAACATCCAGTTGCAGTAGCATTTCCAACTCTTAATCAGCTCGAGA
 
. : . : . : . : . : . :
rJMFF015B23- ACCTCCACTTCGACGATCATACGGCCCAGAACGGTCACGGCTATATCGATCACCACCACC
                      ____________________________________________________________
consensus ACCTCCACTTCGACGATCATACGGCCCAGAACGGTCACGGCTATATCGATCACCACCACC
 
. : . : . : . : . : . :
rJMFF015B23- ACCATCCCTGCTGCGACCACCGCCATACCTGTCACCATTCCGGTCAGGTCCATGATGGCC
                      ____________________________________________________________
consensus ACCATCCCTGCTGCGACCACCGCCATACCTGTCACCATTCCGGTCAGGTCCATGATGGCC
 
. : . : . : . : . : . :
rJMFF015B23- ACCACTGCCACCACCATACCTGTCATCTTTTCCACCGTACCTCCCGCCCCTACCCCCTCC
                      ____________________________________________________________
consensus ACCACTGCCACCACCATACCTGTCATCTTTTCCACCGTACCTCCCGCCCCTACCCCCTCC
 
. : . : . : . : . : . :
rJMFF015B23- TCCTCCACTAGGACATTCCCTAGCGAAGTGTCCTGGCTTACCACACTTGAAGCATTCTCC
                      ____________________________________________________________
consensus TCCTCCACTAGGACATTCCCTAGCGAAGTGTCCTGGCTTACCACACTTGAAGCATTCTCC
 
. : . : . : . : . : . :
rJMFF015B23- TCCACCTGACCCCCGTCCACCTCCATAATCACGACTACCACGGTCACGGTCACGGTCACG
JMFF015B23+ CGGTCACG
                      ____________________________________________________________
consensus TCCACCTGACCCCCGTCCACCTCCATAATCACGACTACCACGGTCACGGTCACGGTCACG
 
. : . : . : . : . : . :
rJMFF015B23- ACCGCGGTCACGATCACGGTCACGGTCACGATCACGATCACGTGGACGATCATTATCATA
JMFF015B23+ ACCGCGGTCACGATCACGGTCACGGTCACGATCACGATCACGTGGACGATCATTATCATA
                      ____________________________________________________________
consensus ACCGCGGTCACGATCACGGTCACGGTCACGATCACGATCACGTGGACGATCATTATCATA
 
. : . : . : . : . : . :
rJMFF015B23- GTCCCTACCTGAACTCTGTTGAGGTTGTGCCTTGTCAACCGTAATGGCGCGACCATCTAA
JMFF015B23+ GTCCCTACCTGAACTCTGTTGAGGTTGTGCCTTGTCAACCGTAATGGCGCGACCATCTAA
                      ____________________________________________________________
consensus GTCCCTACCTGAACTCTGTTGAGGTTGTGCCTTGTCAACCGTAATGGCGCGACCATCTAA
 
. : . : . : . : . : . :
rJMFF015B23- ATCAATTCCATTCATTGCATCAATAGCTTCTTCCATGGCTTTCTTCTCATCAAATGCAAC
JMSF011J22+ TTCTTCTCATCAAATGCAAC
JMFF015B23+ ATCAATTCCATTCATTGCATCAATAGCTTCTTCCATGGCTTTCTTCTCATCAAATGCAAC
                      ____________________________________________________________
consensus ATCAATTCCATTCATTGCATCAATAGCTTCTTCCATGGCTTTCTTCTCATCAAATGCAAC
 
. : . : . : . : . : . :
rJMFF015B23- AAAACCAAACCCTTTGGACCG
JMSF011J22+ AAAACCAAACCCTTTGGACCGACCAGAAAACTTGTCAACAACAACCTTTGCCTCAACAAG
JMFF015B23+ AAAACCAAACCCTTTGGACCGACCAGAAAACTTGTCAACAACAACCTTTGCCTCAACAAG
                      ____________________________________________________________
consensus AAAACCAAACCCTTTGGACCGACCAGAAAACTTGTCAACAACAACCTTTGCCTCAACAAG
 
. : . : . : . : . : . :
JMSF011J22+ ATTTCCAAACTTCCGAAATGCATCTTTTAGAATTTGATCAGATGTTGACCATGACAAGTT
JMFF015B23+ ATTTCCAAACTTCCGAAATGCATCTTTTAGAATTTGATCAGATGTTGACCATGACAAGTT
                      ____________________________________________________________
consensus ATTTCCAAACTTCCGAAATGCATCTTTTAGAATTTGATCAGATGTTGACCATGACAAGTT
 
. : . : . : . : . : . :
JMSF011J22+ ACCAATGAAACAGCGGTACTCGGAATCCTCCGCCATCTTAGTACAAACTCTTGTTTGCTG
JMFF015B23+ ACCAATGAAACAGCGGTACTCGGAATCCTCCGCCATCTTAGTACAAACTCTTGTTTGCTG
                      ____________________________________________________________
consensus ACCAATGAAACAGCGGTACTCGGAATCCTCCGCCATCTTAGTACAAACTCTTGTTTGCTG
 
. : . : . : . : . : . :
JMSF011J22+ AGGCTATGAGGTCTGAGCAACTAAGCAGCGAGACAGGCAGCCAGCGACGGTTGAAGATGA
JMFF015B23+ AGGCTATGAGGTCTGAGCAACTAAGCAGCGAGACAGGCAGCCAGCGACGGTTGAAGATGA
                      ____________________________________________________________
consensus AGGCTATGAGGTCTGAGCAACTAAGCAGCGAGACAGGCAGCCAGCGACGGTTGAAGATGA
 
. : . : . : . : . : . :
JMSF011J22+ AGCCGGTGAC
JMFF015B23+ AGCCGGTGACTGGCAACAAAATGTCGCGACAGAGGCAGAGCAAATTAGCGAAAGAGCGGT
                      ____________________________________________________________
consensus AGCCGGTGACTGGCAACAAAATGTCGCGACAGAGGCAGAGCAAATTAGCGAAAGAGCGGT