Previous Contig 000761:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009N15Sequence541000761 (39)gb:AB018242_15139241e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.630000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFF014N06Sequence473000761 (39)gb:AB018242_15139244e-32Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.706020980gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFF015P11Sequence449000761 (39)gb:AB018242_15139241e-34Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.576000761 (39)gb:AB018242_15139244e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFF016K20Sequence250000761 (39)gb:AC093921_17361551e-08Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0041A22, complet
JMFF020D17Sequence550000761 (39)gb:AC093921_17361554e-18Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0041A22, complet764021113gb:AC108876_17386241e-27Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete s
JMFF036J18Sequence509000761 (39)gb:AB018242_15139241e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.630000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFF039H14Sequence469000761 (39)gb:AB018242_15139242e-39Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.671000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFF039M22Sequence528000761 (39)gb:AB018242_15139243e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFF043A02Sequence646000761 (39)gb:AB018242_15139242e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.512000761 (39)gb:AB018242_15139244e-37Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFF043B12Sequence605000761 (39)gb:AB018242_15139241e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.632000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN003J06Sequence625000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN004B13Sequence595000761 (39)gb:AB018242_15139247e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN008F09Sequence519000761 (39)gb:AB018242_15139241e-30Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN009F04Sequence621000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN009M15Sequence617000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN011P01Sequence622000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN012J02Sequence439000761 (39)gb:AC108876_17386242e-24Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete s
JMFN016I17Sequence611000761 (39)gb:AB018242_15139241e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN020B09Sequence635000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN028G13Sequence591000761 (39)gb:AB018242_15139241e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMFN029J14Sequence304000761 (39)gb:AB018242_15139243e-19Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF002K02Sequence446000761 (39)gb:AB018242_15139243e-30Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.636000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF004M23Sequence317006030 (31)gb:AF139466_17714264e-33Vigna radiata chlorophyll a/b binding protein CP29 (CipCp29) mRNA, complete cds;299000761 (39)gb:AC108876_17386246e-19Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete s
JMSF018F16Sequence496009179 (18)gb:AJ843983_18146758e-40Plantago major mRNA for hypothetical protein.591000761 (39)gb:AB018242_15139241e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF023D05Sequence654000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.656000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF027C09Sequence663000761 (39)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.664000761 (39)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF037E08Sequence662000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.611000761 (39)gb:AB018242_15139241e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF039F13Sequence671000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.665000761 (39)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043B12- CCTTATGGCGGATCACCCTGGTG
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGTG
 
. : . : . : . : . : . :
rJMFF043A02- GGCAACAACAATTTTCATTGATTGATAATGGCAATCCTACAA
JMFN012J02+ TGGCAACAACAATTTTCATTGATTGATAATGGCAATCCTACAA
rJMFF043B12- AGTTTTTTTTTTTTTTTTGGCAACAACAATTTTCATTGATTGATAATGGCAATCCTACAA
JMFN004B13+ TGGCAACAACAATTTTCATTGATTGATAATGGCAATCCTACAA
rJMFF036J18- TTGATTGATAATGGCAATCCTACAA
rJMFF009N15- TTGATTGATAATGGCAATCCTACAA
rJMFF015P11- TTGATTGATAATGGCAATCCTACAA
rJMFF039H14- TTGATTGATAATGGCAATCCTACAA
rJMSF039F13- ATCCTACAA
JMFN020B09+ AATGGCAATCCTACAA
rJMFF039M22- ATAATGGCAATCCTACAA
JMSF039F13+ ATAATGGCAATCCTACAA
rJMSF027C09- A
JMSF027C09+ AATCCTACAA
rJMSF023D05- A
                      ____________________________________________________________
consensus AGTTTTTTTTTTTTTTTTGGCAACAACAATTTTCATTGATTGATAATGGCAATCCTACAA
 
. : . : . : . : . : . :
rJMFF043A02- GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMFN012J02+ GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMFF043B12- GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMFN004B13+ GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMFF036J18- GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMFF009N15- GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMFN003J06+ AGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMFN009M15+ AGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMFF015P11- GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMFF039H14- GGGAAT--AAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMSF039F13- GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMFN020B09+ GGGAATANAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMFF039M22- GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMSF039F13+ GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMSF027C09- GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMFF043A02+ AAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMSF027C09+ GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMFN011P01+ TAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMFN016I17+ GCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMFN028G13+ TCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMSF004M23- GAAGCAGTTATGTTCTCATAACATTCCTGANCAACAANGAACAGTTCTT
JMFN009F04+ TAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMSF023D05- GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
JMSF037E08+ GGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMSF018F16- GTTCTT
JMFF043B12+ ACAACAAAGAACAGTTCTT
rJMSF002K02- CAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
rJMSF037E08- ACAAAGAACAGTTCTT
JMSF023D05+ GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
                      ____________________________________________________________
consensus GGGAATAAAAAGAAGCAGTTATGTTCTCATAACATTCCTGAACAACAAAGAACAGTTCTT
 
. : . : . : . : . : . :
rJMFF043A02- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFN012J02+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMFF043B12- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFN004B13+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMFF036J18- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMFF009N15- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFN003J06+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFN009M15+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMFF015P11- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFF009N15+ TACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFF036J18+ TCCTATGCAGCAGCCTTCTTTGGG
rJMFF039H14- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMSF039F13- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFN020B09+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMFF039M22- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMSF039F13+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMSF027C09- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFF043A02+ CTAATACTACAATTACAGGACTTCACAATCTACTTNTCCTATGCAGCAGCCTTCTTTGGG
JMSF027C09+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFN011P01+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFN016I17+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFN028G13+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMSF004M23- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFN009F04+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMSF023D05- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMSF037E08+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMSF018F16- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMFF043B12+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMSF002K02- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
rJMSF037E08- CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
JMSF023D05+ CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
                      ____________________________________________________________
consensus CTAATACTACAATTACAGGACTTCACAATCTACTTTTCCTATGCAGCAGCCTTCTTTGGG
 
. : . : . : . : . : . :
rJMFF043A02- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN012J02+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMFF043B12- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN004B13+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTACTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMFF036J18- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMFF009N15- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN003J06+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN009M15+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMFF015P11- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN008F09- CTCAGATCCAGTCTTC
JMFF009N15+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFF036J18+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMFF039H14- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMSF039F13- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN020B09+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMFF039M22- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMSF039F13+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMSF027C09- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFF043A02+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMSF027C09+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN011P01+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN016I17+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN028G13+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMSF004M23- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFN009F04+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMSF023D05- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMSF037E08+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMSF018F16- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMFF043B12+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMSF002K02- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
rJMSF037E08- GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
JMSF023D05+ GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
                      ____________________________________________________________
consensus GACTTGGTAGCTTTAGATGGGGATTTCGCCTCCTTTGTTGCCTTCTCAGATCCAGTCTTC
 
. : . : . : . : . : . :
rJMFF043A02- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN012J02+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMFF043B12- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN004B13+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMFF036J18- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMFF009N15- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN003J06+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN009M15+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMFF015P11- TTTGGCAACAACGCAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN008F09- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFF009N15+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFF036J18+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMFF039H14- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMSF039F13- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN020B09+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMFF039M22- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMSF039F13+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMSF027C09- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFF043A02+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMSF027C09+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN011P01+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN016I17+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN028G13+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMSF004M23- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFN009F04+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMSF023D05- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMSF037E08+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMSF018F16- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFF043B12+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFF039H14+ TTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMSF002K02- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
rJMSF037E08- TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMSF002K02+ CGGCAACACACNT-CCATGAGCAATGGTAACACC
JMSF023D05+ TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFF015P11+ TCGGCAACACACCT-CCATGAGCAATGGTAACACC
JMFF014N06+ AACAACACAGGGTTAATGTTCGGCAACACACCTCCCATGAGCAATGGTAACACC
                      ____________________________________________________________
consensus TTTGGCAACAACACAGGGTTAATGTTCGGCAACACACCT-CCATGAGCAATGGTAACACC
 
. : . : . : . : . : . :
rJMFF043A02- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN012J02+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMFF043B12- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN004B13+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMFF036J18- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMFF009N15- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN003J06+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN009M15+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMFF015P11- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN029J14+ ACAGAACATGCCGGGGTA
JMFN008F09- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFF009N15+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFF036J18+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMFF039H14- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMSF039F13- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN020B09+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMFF039M22- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMSF039F13+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMSF027C09- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFF043A02+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMSF027C09+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN011P01+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN016I17+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN028G13+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMSF004M23- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFN009F04+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMSF023D05- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMSF037E08+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMSF018F16- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFF043B12+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFF039H14+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMSF002K02- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
rJMSF037E08- AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMSF002K02+ AGCAAGCAATTTCCCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMSF023D05+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFF015P11+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
JMFF014N06+ AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
                      ____________________________________________________________
consensus AGCAAGCAATTT-CCCAAGCTCCTCATCATTCCTCACAGCCAACAGAACATGCCTTGGTA
 
. : . : . : . : . : . :
rJMFF043A02- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN012J02+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMFF043B12- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN004B13+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCTCTGCCAGCTCCAAAACTTCAGCAG
rJMFF036J18- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMFF009N15- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN003J06+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN009M15+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMFF015P11- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN029J14+ GGATTCTGTTTTTCGTGTTGTCACGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN008F09- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFF009N15+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFF036J18+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMFF039H14- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMSF039F13- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN020B09+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMFF039M22- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMSF039F13+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMSF027C09- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFF043A02+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMSF027C09+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN011P01+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN016I17+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFN028G13+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMSF004M23- TGATTCTGTTTT
JMFN009F04+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMSF023D05- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMSF037E08+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMSF018F16- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFF043B12+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFF039H14+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMSF002K02- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
rJMSF037E08- TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMSF002K02+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFF020D17+ ACTTCAGCAG
JMSF023D05+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFF015P11+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
JMFF014N06+ TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
                      ____________________________________________________________
consensus TGATTCTGTTTTTCTTGTTGTCCCGAGCTGCATTCCCTGCCAGCTCCAAAACTTCAGCAG
 
. : . : . : . : . : . :
rJMFF043A02- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACAACTCCCGACGCGCTCGGCGT
JMFN012J02+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGA
rJMFF043B12- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN004B13+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMFF036J18- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMFF009N15- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN003J06+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN009M15+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMFF015P11- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN029J14+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN008F09- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFF009N15+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFF036J18+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMFF039H14- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMSF039F13- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN020B09+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMFF039M22- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMSF039F13+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMSF027C09- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFF043A02+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACAACTCCCGACGCGCTCGGCGT
JMSF027C09+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN011P01+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN016I17+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN028G13+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFN009F04+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMSF023D05- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMSF037E08+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMSF018F16- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFF043B12+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFF039H14+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMSF002K02- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
rJMSF037E08- CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMSF002K02+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFF020D17+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMSF023D05+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFF015P11+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
JMFF016K20+ TCCCGACGCGCTCGGCGT
JMFF014N06+ CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
                      ____________________________________________________________
consensus CCAAGTATTCCAGAACGGCAGCCATGTAAACCGGAGCACCACTCCCGACGCGCTCGGCGT
 
. : . : . : . : . : . :
rJMFF043A02- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCC
rJMFF043B12- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN004B13+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMFF036J18- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMFF009N15- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN003J06+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN009M15+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMFF015P11- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN029J14+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN008F09- AGCGCCCCTTCTTCAAG
JMFF009N15+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFF036J18+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMFF039H14- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMSF039F13- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN020B09+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMFF039M22- AGCGCCCCTTCNTCANGNACCTCCCGATTCTTCCGACCGGGAACNGAAGGCCAGCGCGGG
JMSF039F13+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMSF027C09- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFF043A02+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMSF027C09+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN011P01+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN016I17+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN028G13+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFN009F04+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMSF023D05- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMSF037E08+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMSF018F16- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFF043B12+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFF039H14+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMSF002K02- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
rJMSF037E08- AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMSF002K02+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFF020D17+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMSF023D05+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFF015P11+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFF016K20+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
JMFF014N06+ AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
                      ____________________________________________________________
consensus AGCGCCCCTTCTTCAAGTACCTCCCGATTCTTCCGACCGGGAACTGAAGGCCAGCGCGGG
 
. : . : . : . : . : . :
rJMFF043B12- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFN004B13+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACAGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMFF036J18- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMFF009N15- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFN003J06+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFN009M15+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMFF015P11- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFN029J14+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFF009N15+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFF036J18+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMFF039H14- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMSF039F13- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFN020B09+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMFF039M22- NGGAGCGAGTAACCGNCTTCTTCTTCGG
JMSF039F13+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMSF027C09- TGGAGCGAGTAACCTGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFF043A02+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMSF027C09+ TGGAGCGAGTAACCTGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFN011P01+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFN016I17+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFN028G13+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFN009F04+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMSF023D05- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMSF037E08+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMSF018F16- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFF043B12+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFF039H14+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMSF002K02- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
rJMSF037E08- TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMSF002K02+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFF020D17+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMSF023D05+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFF015P11+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFF016K20+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
JMFF014N06+ TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
                      ____________________________________________________________
consensus TGGAGCGAGTAACCGGCTTCTTCTTCGGCCCACCGCCCTTCCTGCCGCCGGCGCCCTTCT
 
. : . : . : . : . : . :
rJMFF043B12- TCACTTTTCCG
JMFN004B13+ TCACTTTTCCG
rJMFF036J18- TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
rJMFF009N15- TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFN003J06+ TAACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFN009M15+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
rJMFF015P11- TCACTTTTCCGG
JMFN029J14+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAA
JMFF009N15+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFF036J18+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
rJMFF039H14- TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
rJMSF039F13- TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFN020B09+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMSF039F13+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
rJMSF027C09- TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFF043A02+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMSF027C09+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFN011P01+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFN016I17+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFN028G13+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFN009F04+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
rJMSF023D05- TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMSF037E08+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
rJMSF018F16- TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFF043B12+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFF039H14+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
rJMSF002K02- TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
rJMSF037E08- TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMSF002K02+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFF020D17+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMSF023D05+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFF015P11+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFF016K20+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
JMFF014N06+ TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
                      ____________________________________________________________
consensus TCACTTTTCCGGTGGTCTCCATGAGAAATGTGAAATATCAGTCTAAACCCTGGACTGAAC
 
. : . : . : . : . : . :
rJMFF036J18- GATAAAT
rJMFF009N15- GATAAAT
JMFN003J06+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGA
JMFN009M15+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATG
JMFF009N15+ GATAAAT
JMFF036J18+ GATAAAT
rJMFF039H14- GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCA
rJMSF039F13- GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGT
JMFN020B09+ GATAAATGAAGGAAAGACCGT
JMSF039F13+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGT
rJMSF027C09- GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGTGCC
JMFF043A02+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGT
JMSF027C09+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGTGCC
JMFN011P01+ GATAAATGAAGGAAAGACCGTGTAAGCGA
JMFN016I17+ GATAAATGAAGGAAAGACCGTGTAAGC
JMFN028G13+ GATAAATGAAGGAAAGACC
JMFN009F04+ GATAAATGAAGGAAAGACCGTGTAAGCG
rJMSF023D05- GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGTGCC
JMSF037E08+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGTGCC
rJMSF018F16- GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAA
JMFF043B12+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAA
JMFF039H14+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGT
rJMSF002K02- GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGT
rJMSF037E08- GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGTGCC
JMSF002K02+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGT
JMFF020D17+ GATAAATGAAGGAAAGAACGTGTAAGCGATTAATGTATGAGTATCACAGAGT
JMSF023D05+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGTGCC
JMFF015P11+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGTGCC
JMFF016K20+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGT
JMFF014N06+ GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGTGCCATGAC
                      ____________________________________________________________
consensus GATAAATGAAGGAAAGACCGTGTAAGCGATTAATGTATGAGTATCAAAGAGTGCCATGAC