Previous Contig 000752:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014L06Sequence517000752 (20)807002574 (4)pir|T00587|T00587e-110probable ubiquitin-protein ligase (EC 6.3.2.19) - Arabidopsis thaliana>gb:AC0041
JMFS013C06Sequence527000752 (20)gb:AB124880_15280993e-40Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS030G05Sequence571000752 (20)gb:AB124880_15280996e-12Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS033A07Sequence636000752 (20)gb:AB124880_15280992e-89Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS047H04Sequence593000752 (20)gb:AB124880_15280993e-15Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS049C01Sequence580000752 (20)gb:AB124880_15280995e-48Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS055C12Sequence624000752 (20)gb:AB124880_15280996e-22Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS082E07Sequence627000752 (20)gb:AB124880_15280991e-32Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS095F07Sequence613000752 (20)gb:AB124880_15280993e-49Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS117G05Sequence616000752 (20)gb:AB124880_15280995e-29Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS131G04Sequence614000752 (20)gb:AB124880_15280992e-50Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS136G06Sequence609000752 (20)gb:AB124880_15280992e-92Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS138A04Sequence595000752 (20)gb:AB124880_15280992e-49Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS138B03Sequence614000752 (20)gb:AB124880_15280991e-16Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS139E09Sequence623000752 (20)gb:AB124880_15280996e-22Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS146D04Sequence618000752 (20)gb:AB124880_15280996e-46Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS159G07Sequence554000752 (20)gb:AB124880_15280997e-29Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFS169A10Sequence604000752 (20)gb:AB124880_15280992e-18Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMSF003O02Sequence381000752 (20)813002574 (4)gb:AB124879_1528098e-112Nicotiana tabacum mRNA for ubiquitin activating enzyme 1, complete cds.
JMSF029F24Sequence619000752 (20)gb:AB124880_15280991e-40Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.721002574 (4)gb:AX250451_14648235e-99Sequence 57 from Patent WO0168863.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS136G06+ ACGTAATGGTTTAAAGTTCAAAATTTTTGGTTG
                      ____________________________________________________________
consensus ACGTAATGGTTTAAAGTTCAAAATTTTTGGTTG
 
. : . : . : . : . : . :
JMFS136G06+ CTTCACCTGAGTCACTATACCACCTCTTTCATATGCACCAAACTTTGTTGTATCCTCTTC
                      ____________________________________________________________
consensus CTTCACCTGAGTCACTATACCACCTCTTTCATATGCACCAAACTTTGTTGTATCCTCTTC
 
. : . : . : . : . : . :
JMFS136G06+ AAGGGTGAAAGAATAAGGCCTAGCAGTTAGAATCTTTCTTGGCTTCCCATCATTAAGTTC
                      ____________________________________________________________
consensus AAGGGTGAAAGAATAAGGCCTAGCAGTTAGAATCTTTCTTGGCTTCCCATCATTAAGTTC
 
. : . : . : . : . : . :
JMFS136G06+ TGTCATGCCCCGAACTTCAGAAAATACAACAACATCCCCATCCTGAAACTCAAGCCTCTC
JMFS033A07+ C
                      ____________________________________________________________
consensus TGTCATGCCCCGAACTTCAGAAAATACAACAACATCCCCATCCTGAAACTCAAGCCTCTC
 
. : . : . : . : . : . :
JMFS136G06+ ATCATCCACACATGACACAAGAGCAGGGTTATCATTGCTGATAGAAGCAATGATGCCTGT
JMFS033A07+ ATCATCCACACATGACACAAGAGCAGGGTTATCATTGCTGATAGAAGCAATGATGCCTGT
                      ____________________________________________________________
consensus ATCATCCACACATGACACAAGAGCAGGGTTATCATTGCTGATAGAAGCAATGATGCCTGT
 
. : . : . : . : . : . :
JMFS136G06+ ATGAGGTTCCTCGCCATCAACATCAAAGACCGCAAACTGAGGACCAAAATCACAGAATAT
JMFS033A07+ ATGAGGTTCCTCGCCATCAACATCAAAGACCGCAAACTGAGGACCAAAATCACAGAATAT
                      ____________________________________________________________
consensus ATGAGGTTCCTCGCCATCAACATCAAAGACCGCAAACTGAGGACCAAAATCACAGAATAT
 
. : . : . : . : . : . :
JMFS136G06+ GCTTCCAAAAAGGCCTCTAACATCAGCTTTGATGAATGCAATTGGTGGTTGATGAGTATG
JMFS033A07+ GCTTCCAAAAAGGCCTCTAACATCAGCTTTGATGAATGCAATTGGTGGTTGATGAGTATG
                      ____________________________________________________________
consensus GCTTCCAAAAAGGCCTCTAACATCAGCTTTGATGAATGCAATTGGTGGTTGATGAGTATG
 
. : . : . : . : . : . :
JMFS136G06+ ACAAAAATCATCAAATTCAACTGCCTCCTCTAAGCTTATATCAGTGAACACCACAGCCTG
JMFS033A07+ ACAAAAATCATCAAATTCAACTGCCTCCTCTAAGCTTATATCAGTGAACACCACAGCCTG
JMFS131G04+ AAGCTTATATCAGTGAACACCACAGCCTG
JMFS146D04+ G
                      ____________________________________________________________
consensus ACAAAAATCATCAAATTCAACTGCCTCCTCTAAGCTTATATCAGTGAACACCACAGCCTG
 
. : . : . : . : . : . :
JMFS136G06+ AAACTCAGAGAGCTTTTCTTTCGTCAGTTTTGTGGTCAAGGTTGACACAATAACAGCATT
JMFS033A07+ AAACTCAGAGAGCTTTTCTTTCGTCAGTTTTGTGGTCAAGGTTGACACAATAACAGCATT
JMFS131G04+ AAACTCAGAGAGCTTTTCTTTCGTCAGTTTTGTGGTCAAGGTTGACACAATAACAGCATT
JMFS095F07+ CGTCAGTTTTGTGGTCAAGGTTGACACAATAACAGCATT
JMFS138A04+ TTCGTCAGTTTTGTGGTCAAGGTTGACACAATAACAGCATT
JMFS013C06+ AAGGTTGACACAATAACAGCATT
JMFS049C01+ GTCAAGGTTGACACAATAACAGCATT
JMFS146D04+ AAACTCAGAGAGCTTTTCTTTCGTCAGTTTTGTGGTCAAGGTTGACACAATAACAGCATT
                      ____________________________________________________________
consensus AAACTCAGAGAGCTTTTCTTTCGTCAGTTTTGTGGTCAAGGTTGACACAATAACAGCATT
 
. : . : . : . : . : . :
JMFS136G06+ GTTGAGCTCTTGAAGTTTTTGTACAGAAGCAAGTGCCCTATTCTTGCCAACATCAGTCTC
JMFS033A07+ GTTGAGCTCTTGAAGTTTTTGTACAGAAGCAAGTGCCCTATTCTTGCCAACATCAGTCTC
JMFS131G04+ GTTGAGCTCCTGAAGTTTTTGTACAGAAGCAAGTGCCCTATTCTTGCCAACATCAGTCTC
JMFS095F07+ GTTGAGCTCTTGAAGTTTTTGTACAGAAGCAAGTGCCCTATTCTTGCCAACATCAGTCTC
JMFS138A04+ GTTGAGCTCTTGAAGTTTTTGTACAGAAGCAAGTGCCCTATTCTTGCCAACATCAGTCTC
JMFS013C06+ GTTGAGCTCTTGAAGTTTTTGTACAGAAGCAAGTGCCCTA-TCTTGCCAACATCAGTCTC
JMFS049C01+ GTTGAGCTCTTGAAGTTTTTGTACAGAAGCAAGTGCCCTATTCTTGCCAACATCAGTCTC
JMFS146D04+ GTTGAGCTCTTGAAGTTTTTGTGCAGAAGCAAGTGCCCTATTCTTGCCAACATCAGTCTC
JMSF029F24+ TTGTACAGAAGCAAGTGCCCTATTCTTGCCAACATCAGTCTC
                      ____________________________________________________________
consensus GTTGAGCTCTTGAAGTTTTTGTACAGAAGCAAGTGCCCTATTCTTGCCAACATCAGTCTC
 
. : . : . : . : . : . :
JMFS136G06+ TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTC
JMFS033A07+ TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMFS131G04+ TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMFS095F07+ TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMFS138A04+ TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMFS013C06+ TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMFS049C01+ TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMFS146D04+ TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMSF029F24+ TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMFS159G07+ CCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMFS082E07+ AAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
JMFS117G05+ ATCCCAAAGCTCCCCCGTGCCTTCATCATGCAGTGT
                      ____________________________________________________________
consensus TGAGAATAAAAAATTGCTTGACAAATCCCAAAGCTCCACCGTGCCTTCATCATGCAGTGT
 
. : . : . : . : . : . :
JMFS033A07+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS131G04+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS095F07+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS138A04+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS013C06+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS049C01+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS146D04+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMSF029F24+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS159G07+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS082E07+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS117G05+ CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS139E09+ CAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS169A10+ AAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS055C12+ CAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
JMFS047H04+ CAGCACCAAGGCCTTGCAA
JMFS138B03+ TGGCGATCTCAGCACCAAGGCCTTGCAA
                      ____________________________________________________________
consensus CACAGATTTCACACCAGCAAGGACAAGATTCTTGGCGATCTCAGCACCAAGGCCTTGCAA
 
. : . : . : . : . : . :
JMFS033A07+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS131G04+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS095F07+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS138A04+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS013C06+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS049C01+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS146D04+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMSF029F24+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS159G07+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS082E07+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS117G05+ TCCCGAGACGAGGACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS139E09+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS169A10+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS055C12+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMSF003O02+ GTCCATACACGGC
JMFS047H04+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS030G05+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
JMFS138B03+ TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
                      ____________________________________________________________
consensus TCCCGAGACAAGAACATTGGAAGCAAAAAGCCGGCGCATAGTCTCGCGTCCATACACGGC
 
. : . : . : . : . : . :
JMFS033A07+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS131G04+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS095F07+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS138A04+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS013C06+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS049C01+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS146D04+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMSF029F24+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS159G07+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS082E07+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS117G05+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS139E09+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS169A10+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS055C12+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMSF003O02+ AAGCTGCCTGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATCNAAACGCCA
JMFS047H04+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS030G05+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFS138B03+ AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
JMFF014L06+ TCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
                      ____________________________________________________________
consensus AAGCTGCCGGCTATGGAGATCCTCGTCAATGTCGTGCGGATTACCATCATC-AAACGCCA
 
. : . : . : . : . : . :
JMFS033A07+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGC
JMFS131G04+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS095F07+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS138A04+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS013C06+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS049C01+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS146D04+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMSF029F24+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS159G07+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS082E07+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS117G05+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS139E09+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS169A10+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS055C12+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMSF003O02+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS047H04+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS030G05+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFS138B03+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
JMFF014L06+ TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
                      ____________________________________________________________
consensus TGTCCTTCAGCGACGCCTCGCCAACACTCTTACTGCCGCTGGTGCTACCGTTGGTGCTAG
 
. : . : . : . : . : . :
JMFS131G04+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS095F07+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS138A04+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS013C06+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS049C01+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS146D04+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMSF029F24+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS159G07+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS082E07+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS117G05+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS139E09+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS169A10+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS055C12+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMSF003O02+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS047H04+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS030G05+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFS138B03+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
JMFF014L06+ AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
                      ____________________________________________________________
consensus AGCCGCTCTTCCCTATACTATCGGTGTCGCAGGAGCCGCTAGTCTTCTCTGTGGCTGCGG
 
. : . : . : . : . : . :
JMFS131G04+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS095F07+ AGGAGATCAAAAAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS138A04+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS013C06+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS049C01+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS146D04+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMSF029F24+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS159G07+ AGGAGATCAAACAACCGATCCGATTCCTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS082E07+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS117G05+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS139E09+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS169A10+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS055C12+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMSF003O02+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS047H04+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS030G05+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFS138B03+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
JMFF014L06+ AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
                      ____________________________________________________________
consensus AGGAGATCAAACAACCGATCCGATTCTTCTTGCCTACGCTATCGGGATCAACGCAAGTGC
 
. : . : . : . : . : . :
JMFS131G04+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAG
JMFS095F07+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS138A04+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS013C06+ TGCTACCGTCAACAACCTCGCC
JMFS049C01+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS146D04+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMSF029F24+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS159G07+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS082E07+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS117G05+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS139E09+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS169A10+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS055C12+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMSF003O02+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS047H04+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS030G05+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFS138B03+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
JMFF014L06+ TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
                      ____________________________________________________________
consensus TGCTACCGTCAACAACCTCGCCTTCCACAGGTCTCTTTCTAGGAAGCATATAGTGCAACA
 
. : . : . : . : . : . :
JMFS095F07+ CGCTGC
JMFS138A04+ C---GCGATTGGAGCTGA
JMFS049C01+ C---GCGATTGGAGCTGA
JMFS146D04+ C---GCGATTGGAGCTGAGGA
JMSF029F24+ CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMFS159G07+ CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCACC
JMFS082E07+ CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMFS117G05+ CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMFS139E09+ CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMFS169A10+ CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMFS055C12+ C---GCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMSF003O02+ CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMFS047H04+ CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMFS030G05+ C---GCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMFS138B03+ C---GCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
JMFF014L06+ CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
                      ____________________________________________________________
consensus CGCTGCGATTGGAGCTGAGGAGAAGAAAGGAATGGAATCGGAAATGGAAACGAGAGCAGC
 
. : . : . : . : . : . :
JMSF029F24+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGC
JMFS159G07+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGA
JMFS082E07+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
JMFS117G05+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
JMFS139E09+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
JMFS169A10+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
JMFS055C12+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
JMSF003O02+ AGTGAT
JMFS047H04+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
JMFS030G05+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
JMFS138B03+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
JMFF014L06+ AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
                      ____________________________________________________________
consensus AGTGATTGAGTTAGGCTTTGGTTTTGGATTTTCGCTTGGGGAAGGGTAACTTGGTGAAGA
 
. : . : . : . : . : . :
JMFS082E07+ ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATT
JMFS117G05+ ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATTTGAA
JMFS139E09+ ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATTTGAAGGGAAAAGAGCTATGAGTT
JMFS169A10+ ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATTTGAAGGGAAAAGAGCTATGAGTT
JMFS055C12+ ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATTTGAAGGGAAAAGAGCTATGAGTT
JMFS047H04+ ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATTTGAAGGGAAAAGAGCTATGAGTT
JMFS030G05+ ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATTTGAAGGGAAAAGAGCTATGAGTT
JMFS138B03+ ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATTTGAAGGGAAAAGAGCTATGAGTT
JMFF014L06+ ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATTTGAAGGGAAAAGAGCTATGAGTT
                      ____________________________________________________________
consensus ATTTTCATAGGGGGGAGCGAAGGGTATTTACGGGATTTGAAGGGAAAAGAGCTATGAGTT
 
. : . : . : . : . : . :
JMFS139E09+ AGGGTTTTGCGAAGAGACAAGTAGTT
JMFS169A10+ AGGGTTTTGCGAAGAGACAAGTAGTTTCT
JMFS055C12+ AGGGTTTTGCGAAGAGACAAGTAGTTTCTT
JMFS047H04+ AGGGTTTTGCGAAGAGACAAGTAGTTTCTTAT
JMFS030G05+ AGGGTTTTGCGAAGAGACAAGTAGTTTCTTAT
JMFS138B03+ AGGGTTTTGCGAAGAGACAAGTAGTTTCTTATCTATGGCCCTCTATGGAG
JMFF014L06+ AGGGTTTTGCGAAGAGACAAGTAGTTTCTTATCTATGGCCCTCTATGGAGAAGGCGATAC
                      ____________________________________________________________
consensus AGGGTTTTGCGAAGAGACAAGTAGTTTCTTATCTATGGCCCTCTATGGAGAAGGCGATAC