Previous Contig 000749:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011M22Sequence581000749 (11)gb:AJ870305_18150935e-66Cucumis sativus mRNA for putative serine-threonine protein kinase (se4a11 gene).
JMFF014I10Sequence202000749 (11)762000749 (11)pir|T50501|T505011e-82serine/threonine protein kinase - Arabidopsis thaliana>gb:ATT22D6_1555227 Arabid
JMFF019E18Sequence545000749 (11)gb:AJ870305_18150938e-61Cucumis sativus mRNA for putative serine-threonine protein kinase (se4a11 gene).710000749 (11)pir|T50501|T505012e-81serine/threonine protein kinase - Arabidopsis thaliana>gb:ATT22D6_1555227 Arabid
JMFF035G24Sequence565000749 (11)gb:AJ870305_18150932e-63Cucumis sativus mRNA for putative serine-threonine protein kinase (se4a11 gene).675000749 (11)gb:AY088294_15733141e-72Arabidopsis thaliana clone 5323 mRNA, complete sequence.
JMFF036H10Sequence562000749 (11)gb:AJ870305_18150932e-63Cucumis sativus mRNA for putative serine-threonine protein kinase (se4a11 gene).764000749 (11)pir|T50501|T505015e-82serine/threonine protein kinase - Arabidopsis thaliana>gb:ATT22D6_1555227 Arabid
JMSF021L24Sequence702000749 (11)pir|T50501|T505017e-97serine/threonine protein kinase - Arabidopsis thaliana>gb:ATT22D6_1555227 Arabid782000749 (11)gb:AJ870305_18150931e-90Cucumis sativus mRNA for putative serine-threonine protein kinase (se4a11 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF036H10- TATATATATT
rJMFF014I10- ATATATT
                      ____________________________________________________________
consensus TATATATATT
 
. : . : . : . : . : . :
rJMFF036H10- ATAATAAAAATGAATGTAACCATTTACTTAAACTAGGTATAAGACATTTTATGAATCCAC
rJMFF035G24- ATTTTATGAATCCAC
rJMFF014I10- ATAATAAAAATGAATGTAACCATTTACTTAAACTAGGTATAAGACATTTTATGAATCCAC
rJMFF019E18- TTTATGAATCCAC
rJMSF021L24- CATTTACTTAAACTAGGTATAAGACATTTTATGAATCCAC
                      ____________________________________________________________
consensus ATAATAAAAATGAATGTAACCATTTACTTAAACTAGGTATAAGACATTTTATGAATCCAC
 
. : . : . : . : . : . :
rJMFF036H10- ATTGAAGTTCAGGCACTCATATATCACAGAGCAAAAGATAGATATTGGCCATTTCTTGAA
rJMFF035G24- ATTGAAGTTCAGGCACTCATATATCACAGAGCAAAAGATAGATATTGGCCATTTCTTGAA
rJMFF014I10- ATTGAAGTTCAGGCACTCATATATCACAGAGCAAAAGATAGATATTGGCCATTTCTTGAA
rJMFF019E18- ATTGAAGTTCAGGCACTCATATATCACAGAGCAAAAGATAGATATTGGCCATTTCTTGAA
rJMSF021L24- ATTGAAGTTCAGGCACTCATATATCACAGAGCAAAAGATAGATATTGGCCATTTCTTGAA
                      ____________________________________________________________
consensus ATTGAAGTTCAGGCACTCATATATCACAGAGCAAAAGATAGATATTGGCCATTTCTTGAA
 
. : . : . : . : . : . :
rJMFF036H10- TTAAAACCAAAAGAAAAATGCAACTGCAAAAACCTCCTCCAGTATGTTGTCCCTAACCAA
rJMFF035G24- TTAAAACCAAAAGAAAAATGCAACTGCAAAAACCTCCTCCAGTATGTTGTCCCTAACCAA
rJMFF014I10- TTAAAACCAAAAGAAAAATGCAACTGCAAAAACCTCCTCCAGTATGTTGTCCCTAACCAA
rJMFF019E18- TTAAAACCAAAAGAAAAATGCAACTGCAAAAACCTCCTCCAGTATGTTGTCCCTAACCAA
rJMSF021L24- TTAAAACCAAAAGAAAAATGCAACTGCAAAAACCTCCTCCAGTATGTTGTCCCTAACCAA
                      ____________________________________________________________
consensus TTAAAACCAAAAGAAAAATGCAACTGCAAAAACCTCCTCCAGTATGTTGTCCCTAACCAA
 
. : . : . : . : . : . :
rJMFF036H10- TGACGACCTATGCTTCTTATCATATTTTTCGCAAAGTAATTATGAGCATGTCTCTTAGGT
rJMFF035G24- TGACGACCTATGCTTCTTATCATATTTTTCGCAAAGTAATTATGAGCATGTCTCTTAGGT
rJMFF014I10- TGACGACCTATGCTTCTTATCATATTTTTCGCAAAGTAATTATGAGCATGTCTCTTAGGT
rJMFF019E18- TGACGACCTATGCTTCTTATCATATTTTTCGCAAAGTAATTATGAGCATGTCTCTTAGGT
rJMSF021L24- TGACGACCTATGCTTCTTATCATATTTTTCGCAAAGTAATTATGAGCATGTCTCTTAGGT
                      ____________________________________________________________
consensus TGACGACCTATGCTTCTTATCATATTTTTCGCAAAGTAATTATGAGCATGTCTCTTAGGT
 
. : . : . : . : . : . :
rJMFF036H10- CGACAGCGCACCTCTCAGTGAGAGAACTTCGAGATCAACTTATCAACGTGAATCACAATA
rJMFF035G24- CGACAGCGCACCTCTCAGTGAGAGAACTTCGAGATCAACTTATCAACGTGAATCACAATA
rJMFF014I10- CGACAGCGCACCTCTCAGTGAGAGAACTTCGAGATCAACTTATCAACGTGAATCACAATA
rJMFF019E18- CGACAGCGCACCTCTCAGTGAGAGAACTTCGAGATCAACTTATCAACGTGAATCACAATA
rJMSF021L24- CGACAGCGCACCTCTCAGTGAGAGAACTTCGAGATCAACTTATCAACGTGAATCACAATA
                      ____________________________________________________________
consensus CGACAGCGCACCTCTCAGTGAGAGAACTTCGAGATCAACTTATCAACGTGAATCACAATA
 
. : . : . : . : . : . :
rJMFF036H10- TCATCTATGTGGGGGCGAACAGTTGCTTGAGGCTGAAGCATCCATGTCACGAACTGGTGA
rJMFF035G24- TCATCTATGTGGGGGCGAACAGTTGCTTGAGGCTGAAGCATCCATGTCACGAACTGGTGA
rJMFF014I10- TCATCTATGTGGGGGCGAACAGTTGCTTGAGGCTGAAGCATCCATGTCACGAACTGGTGA
rJMFF019E18- TCATCTATGTGGGGGCGAACAGTTGCTTGAGGCTGAAGCATCCATGTCACGAACTGGTGA
rJMSF021L24- TCATCTATGTGGGGGCGAACAGTTGCTTGAGGCTGAAGCATCCATGTCACGAACTGGTGA
                      ____________________________________________________________
consensus TCATCTATGTGGGGGCGAACAGTTGCTTGAGGCTGAAGCATCCATGTCACGAACTGGTGA
 
. : . : . : . : . : . :
rJMFF036H10- AGGGCTTCGGGATATTTGGGGTCAGAAAGACCTGTTGGCCACTTTACCTGAGCATTAACA
rJMFF035G24- AGGGCTTCGGGATATTTGGGGTCAGAAAGACCTGTTGGCCACTTTACCTGAGCATTAACA
rJMFF014I10- AGGGCTTCGGGATATTTGGGGTCAGAAAGACCTGTTGGCCACTTTACCTGAGCATTAACA
rJMFF019E18- AGGGCTTCGGGATATTTGGGGTCAGAAAGACCTGTTGGCCACTTTACCTGAGCATTAACA
rJMSF021L24- AGGGCTTCGGGATATTTGGGGTCAGAAAGACCTGTTGGCCACTTTACCTGAGCATTAACA
                      ____________________________________________________________
consensus AGGGCTTCGGGATATTTGGGGTCAGAAAGACCTGTTGGCCACTTTACCTGAGCATTAACA
 
. : . : . : . : . : . :
rJMFF036H10- ATGGCCAACTGTAGGCTTCCACCGGATTCCCCAAGCGCATACTCAAACGGGGACACTCCA
rJMFF035G24- ATGGCCAACTGTAGGCTTCCACCGGATTCCCCAAGCGCATACTCAAACGGGGACACTCCA
rJMFF014I10- ATGGCCAACTGTAGGCTTCCACCGGATTCCCCAAGCGCATACTCAAACGGGGACACTCCA
rJMFF019E18- ATGGCCAACTGTAGGCTTCCACCGGATTCCCCAAGCGCATACTCAAACGGGGACACTCCA
rJMSF021L24- ATGGCCAACTGTAGGCTTCCACCGGATTCCCCAAGCGCATACTCAAACGGGGACACTCCA
                      ____________________________________________________________
consensus ATGGCCAACTGTAGGCTTCCACCGGATTCCCCAAGCGCATACTCAAACGGGGACACTCCA
 
. : . : . : . : . : . :
rJMFF036H10- TACATTATTGCATATAAAGTACAACCCAATGACCAGATATCAGTTCTTTCATCAATATCA
rJMFF035G24- TACATTATTGCATATAAAGTACAACCCAATGACCAGATATCAGTTCTTTCATCAATATCA
rJMFF014I10- TACATTATTGCATATAAAGTACAACCCAATGACCAGATATCAGTTCTTTCATCAATATCA
rJMFF019E18- TACATTATTGCATATAAAGTACAACCCAATGACCAGATATCAGTTCTTTCATCAATATCA
rJMSF021L24- TACATTATTGCATATAAAGTACAACCCAATGACCAGATATCAGTTCTTTCATCAATATCA
                      ____________________________________________________________
consensus TACATTATTGCATATAAAGTACAACCCAATGACCAGATATCAGTTCTTTCATCAATATCA
 
. : . : . : . : . : . :
rJMFF036H10- GCATGGCTTGGGCAATCCCACAGTTCAGGAGCTCGGAAGGGTGCTGAGACATGCTCCGAT
rJMFF035G24- GCATGGCTTGGGCAATCCCACAGTTCAGGAGCTCGGAAGGGTGCTGAGACATGCTCCGAT
rJMFF014I10- GCATGGCTTGGGCAATCCCACAGTTCAGGAGCTCGGAAGGGTGCTGAGACATGCTCCGAT
rJMFF019E18- GCATGGCTTGGGCAATCCCACAGTTCAGGAGCTCGGAAGGGTGCTGAGACATGCTCCGAT
rJMSF021L24- GCATGGCTTGGGCAATCCCACAGTTCAGGAGCTCGGAAGGGTGCTGAGACATGCTCCGAT
                      ____________________________________________________________
consensus GCATGGCTTGGGCAATCCCACAGTTCAGGAGCTCGGAAGGGTGCTGAGACATGCTCCGAT
 
. : . : . : . : . : . :
rJMFF036H10- GCCCATTCCTGCAACTGTAAAGCCTCTGAACGAGACCGTATTTGCTTTCTTGCAGGACGA
rJMFF035G24- GCCCATTCCTGCAACTGTAAAGCCTCTGAACGAGACCGTATTTGCTTTCTTGCAGGACGA
rJMFF014I10- GCCCATTCCTGCAACTGTAAAGCCTCTGAACGAGACCGTATTTGCTTTCTTGCAGGACGA
rJMFF019E18- GCCCATTCCTGCAACTGTAAAGCCTCTGAACGAGACCGTATTTGCTTTCTTGCAGGACGA
rJMSF021L24- GCCCATTCCTGCAACTGTAAAGCCTCTGAACGAGACCGTATTTGCTTTCTTGCAGGACGA
JMSF021L24+ CAGGACGA
                      ____________________________________________________________
consensus GCCCATTCCTGCAACTGTAAAGCCTCTGAACGAGACCGTATTTGCTTTCTTGCAGGACGA
 
. : . : . : . : . : . :
rJMFF036H10- GCACTTCCAAAATCCATCAATATTGCAAGAGGTGG-TTGCCCTTTTCTATGTGTCAAAAN
rJMFF035G24- GCACTTCCAAAATCCATCAATATTGCAAGAGGTGGNTTGCCCTTTTCTATGTGTCAAAAG
rJMFF014I10- GCACTTCCAAAATCCATCAATATTGCAAGAGGTGG-TTGCCCTTTTCTATGTGTCAAAAG
rJMFF019E18- GCACTTCCAAAATCCATCAATATTGCAAGAGGTGG-TTGCCCTTTTCTATGTGTCAAAAN
rJMSF021L24- GCACTTCCAAAATCCATCAATATTGCAAGAGGTGG-TTGCCCTTTTCTATGTGTCAAAAG
JMSF021L24+ GCACTTCCAAAATCCATCAATATTGCAAGAGGTGG-TTGCCCTTTTCTATGTGTCAAAAG
                      ____________________________________________________________
consensus GCACTTCCAAAATCCATCAATATTGCAAGAGGTGG-TTGCCCTTTTCTATGTGTCAAAAG
 
. : . : . : . : . : . :
rJMFF036H10- GACATTGCCAGGTTTTACATCATTATGTGCATAGG
rJMFF014I10- GACATTGCCAGGTTTTACATCATTATGTGCATAGGA
rJMFF019E18- GACATTGCCAGGNTTTACATCATTATGTGCATAGGA
rJMSF021L24- GACATTGCCAGGTTTTACATCATTATGTGCATAGGATGGTTCAAAATTGTGCATATGCTT
JMSF021L24+ GACATTGCCAGGTTTTACATCATTATGTGCATAGGATGGTTCAAAATTGTGCATATGCTT
                      ____________________________________________________________
consensus GACATTGCCAGGTTTTACATCATTATGTGCATAGGATGGTTCAAAATTGTGCATATGCTT
 
. : . : . : . : . : . :
rJMSF021L24- GAGTCCTGCACAAAGCTGACGAA
JMSF021L24+ GAGTCCTGCACAAAGCTGACGAAATATTTGAAGAACATCTGAGGTAGAAAAGGACTCCTT
JMFF011M22+ GTAGAAAAGGACTCCTT
                      ____________________________________________________________
consensus GAGTCCTGCACAAAGCTGACGAAATATTTGAAGAACATCTGAGGTAGAAAAGGACTCCTT
 
. : . : . : . : . : . :
JMSF021L24+ CTTTGCTTTCATAGCCGTGGCATTGTCCAGCAAGGTTCCATCCATGTGGACAGGAAACAA
JMFF036H10+ TTGCTTTCATAGCCGTGGCATTGTCCAGCAAGGTTCCATCCATGTGGACAGGAAACAA
JMFF011M22+ CTTTGCTTTCATAGCCGTGGCATTGTCCAGCAAGGTTCCATCCATGTGGACAGGAAACAA
JMFF035G24+ TTGCTTTCATAGCCGTGGCATTGTCCAGCAAGGTTCCATCCATGTGGACAGGAAACAA
JMFF019E18+ TTGTCCAGCAAGGTTCCATCCATGTGGACAGGAAACAA
                      ____________________________________________________________
consensus CTTTGCTTTCATAGCCGTGGCATTGTCCAGCAAGGTTCCATCCATGTGGACAGGAAACAA
 
. : . : . : . : . : . :
JMSF021L24+ TAAGTATGCTTCATGCTTCCAAGATTGACCTTCAGAGGCCTTGACAGCTATGACAGCATG
JMFF036H10+ TAAGTATGCTTCATGCTTCCAAGATTGACCTTCAGAGGCCTTGACAGCTATGACAGCATG
JMFF011M22+ TAAGTATGCTTCATGCTTCCAAGATTGACCTTCAGAGGCCTTGACAGCTATGACAGCATG
JMFF035G24+ TAAGTATGCTTCATGCTTCCAAGATTGACCTTCAGAGGCCTTGACAGCTATGACAGCATG
JMFF019E18+ TAAGTATGCTTCATGCTTCCAAGATTGACCTTCAGAGGCCTTGACAGCTATGACAGCATG
                      ____________________________________________________________
consensus TAAGTATGCTTCATGCTTCCAAGATTGACCTTCAGAGGCCTTGACAGCTATGACAGCATG
 
. : . : . : . : . : . :
JMSF021L24+ ATCAAGGAGAGGAAGCAGATTGGGATGACTAAACAGTGATGAAACACGGATCTCTTCCTT
JMFF036H10+ ATCAAGGAGAGGAAGCAGATTGGGATGACTAAACAGTGATGAAACACGGATCTCTTCCTT
JMFF011M22+ ATCAAGGAGAGGAAGCAGATTGGGATGACTAAACAGTGATGAAACACGGATCTCTTCCTT
JMFF035G24+ ATCAAGGAGAGGAAGCAGATTGGGATGACTAAACAGTGATGAAACACGGATCTCTTCCTT
JMFF019E18+ ATCAAGGAGAGGAAGCAGATTGGGATGACTAAACAGTGATGAAACACGGATCTCTTCCTT
                      ____________________________________________________________
consensus ATCAAGGAGAGGAAGCAGATTGGGATGACTAAACAGTGATGAAACACGGATCTCTTCCTT
 
. : . : . : . : . : . :
JMSF021L24+ CACCAAATCCAATTGTTCACTATTCTGAATAAGAACTTTCTTCATTGCATAAGTTCCATT
JMFF036H10+ CACCAAATCCAATTGTTCACTATTCTGAATAAGAACTTTCTTCATTGCATAAGTTCCATT
JMFF011M22+ CACCAAATCCAATTGTTCACTATTCTGAATAAGAACTTTCTTCATTGCATAAGTTCCATT
JMFF035G24+ CACCAAATCCAATTGTTCACTATTCTGAATAAGAACTTTCTTCATTGCATAAGTTCCATT
JMFF019E18+ CACCAAATCCAATTGTTCACTATTCTGAATAAGAACTTTCTTCATTGCATAAGTTCCATT
                      ____________________________________________________________
consensus CACCAAATCCAATTGTTCACTATTCTGAATAAGAACTTTCTTCATTGCATAAGTTCCATT
 
. : . : . : . : . : . :
JMSF021L24+ ATCAGAGGCATGAGAAGGGTCCTTGAATTTCTTGGAAACTCCGGGTTTGGCGGGGTCGGC
JMFF036H10+ ATCAGAGGCATGAGAAGGGTCCTTGAATTTCTTGGAAACTCCGGGTTTGGCGGGGTCGGC
JMFF011M22+ ATCAGAGGCATGAGAAGGGTCCTTGAATTTCTTGGAAACTCCGGGTTTGGCGGGGTCGGC
JMFF035G24+ ATCAGAGGCATGAGAAGGGTCCTTGAATTTCTTGGAAACTCCGGGTTTGGCGGGGTCGGC
JMFF019E18+ ATCAGAGGCATGAGAAGGGTCCTTGAATTTCTTGGAAACTCCGGGTTTGGCGGGGTCGGC
                      ____________________________________________________________
consensus ATCAGAGGCATGAGAAGGGTCCTTGAATTTCTTGGAAACTCCGGGTTTGGCGGGGTCGGC
 
. : . : . : . : . : . :
JMSF021L24+ GAGGATCTCCTTCACAAGGTAGACGTACGCGAAGCCACCCTCGCCGAGCTGGCGGACGAT
JMFF036H10+ GAGGATCTCCTTCACAAGGTAGACGTACGCGAAGCCACCCTCGCCGAGCTGGCGGACGAT
JMFF011M22+ GAGGATCTCCTTCACAAGGTAGACGTACGCGAAGCCACCCTCGCCGAGCTGGCGGACGAT
JMFF035G24+ GAGGATCTCCTTCACAAGGTAGACGTACGCGAAGCCACCCTCGCCGAGCTGGCGGACGAT
JMFF019E18+ GAGGATCTCCTTCACAAGGTAGACGTACGCGAAGCCACCCTCGCCGAGCTGGCGGACGAT
                      ____________________________________________________________
consensus GAGGATCTCCTTCACAAGGTAGACGTACGCGAAGCCACCCTCGCCGAGCTGGCGGACGAT
 
. : . : . : . : . : . :
JMSF021L24+ CCGGAACCGGTTATCATTGATCCAGACGTCACCACCGCCGTTGACGGCGTCGTACAGAGC
JMFF036H10+ CCGGAACCGGTTATCATTGATCCAGACGTCACCACCGCCGTTGACGGCGTCGTACAGAGC
JMFF011M22+ CCGGAACCGGTTATCATTGATCCAGACGTCACCACCGCCGTTGACGGCGTCGTACAGAGC
JMFF035G24+ CCGGAACCGGTTATCATTGATCCAGACGTCACCACCGCCGTTGACGGCGTCGTACAGAGC
JMFF019E18+ CCGGAACCGGTTATCATTGATCCAGACGTCACCACCGCCGTTGACGGCGTCGTACAGAGC
JMFF014I10+ CGTTGACGGCGTCGTACAGAGC
                      ____________________________________________________________
consensus CCGGAACCGGTTATCATTGATCCAGACGTCACCACCGCCGTTGACGGCGTCGTACAGAGC
 
. : . : . : . : . : . :
JMSF021L24+ ATTCAGCCCCGAGAACGAGCACCCCATCTTCTTTCTAGCAATGGGTCAGCTCCCTCTCGC
JMFF036H10+ ATTCAGCCCCGAGAACGAGCACCCCATCTTCTTTCTAGCAATGGGTCAGCTCCCTCTCGC
JMFF011M22+ ATTCAGCCCCGAGAACGAGCACCCCATCTTCTTTCTAGCAATGGGTCAGCTCCCTCTCGC
JMFF035G24+ ATTCAGCCCCGAGAACGAGCACCCCATCTTCTTTCTAGCAATGGGTCAGCTCCCTCTCGC
JMFF019E18+ ATTCAGCCCCGAGAACGAGCACCCCATCTTCTTTCTAGCAATGGGTCAGCTCCCTCTCGC
JMFF014I10+ ACTCAGCCCCGAGAACGAGCACCCCATCTTCTTTCTAGCAATGGGTCAGCTCCCTCTCGC
                      ____________________________________________________________
consensus ATTCAGCCCCGAGAACGAGCACCCCATCTTCTTTCTAGCAATGGGTCAGCTCCCTCTCGC
 
. : . : . : . : . : . :
JMSF021L24+ TTCTCACTCTAGATCTCTAACAAAATTCTCT
JMFF036H10+ TTCTCACTCTAGATCTCTAACAAAATTCTCTCTCTCTCTAGGAATGGAAGTTTTCCGTAG
JMFF011M22+ TTCTCACTCTAGATCTCTAACAAAATTCTCTCTCTCTCTAGGAATGGAAGTTTTCCGTAG
JMFF035G24+ TTCTCACTCTAGATCTCTAACAAAATTCTCTCTCTCTCTAGGAATGGAAGTTTTCCGTAG
JMFF019E18+ TTCTCACTCTAGATCTCTAACAAAATTCTCTCTCTCTCTAGGAATGGAAGTTTTCCGTAG
JMFF014I10+ TTCTCACTCTAGATCTCTAACAAAATTCTCTCTCTCTCTAGGAATGGAAGTTTTCCGTAG
                      ____________________________________________________________
consensus TTCTCACTCTAGATCTCTAACAAAATTCTCTCTCTCTCTAGGAATGGAAGTTTTCCGTAG
 
. : . : . : . : . : . :
JMFF036H10+ CCTGGTAAGAGTTGGAGGTATCTC
JMFF011M22+ CCTGGTAAGAGTTGGAGGTATCTC
JMFF035G24+ CCTGGTAAGAGTTGGAGGTATCTC
JMFF019E18+ CCTGGTAAGAGTTGGAGGTATCTC
JMFF014I10+ CCTGGTAAGAGTTGGAGGTATCTCAGTATCTCCCTCGTCGCGGATCCACCACACGAAGAT
                      ____________________________________________________________
consensus CCTGGTAAGAGTTGGAGGTATCTCAGTATCTCCCTCGTCGCGGATCCACCACACGAAGAT