Previous Contig 000746:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014G23Sequence451000746 (5)322010566 (4)
JMFF035C05Sequence542000746 (5)gb:AB022211_15149832e-04Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1L20.>gb:AY136450_158308010566 (4)
JMFF045K03Sequence521000746 (5)gb:AB022211_15149839e-06Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1L20.>gb:AY136450_158582010566 (4)pir|T45739|T457399e-35transcription factor-like protein - Arabidopsis thaliana>gb:ATF24M12_1549947 Ara
JMFF046F20Sequence435000746 (5)402010566 (4)
JMFS051B01Sequence612000746 (5)gb:AB022211_15149831e-05Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1L20.>gb:AY136450_158

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS051B01+ GCTGGGATTGTCTCGGACCGGAATTTCGGCCTGAAC
                      ____________________________________________________________
consensus GCTGGGATTGTCTCGGACCGGAATTTCGGCCTGAAC
 
. : . : . : . : . : . :
JMFF045K03+ AAGCGGCGGCAGCTTCCGGGCGGGGTATGTTAGAGAGTAGCC
JMFS051B01+ CCGGTTCTTGTTTTCCGGAAGCGGCGGCAGCTNTCCGGCGGGGTATGTTAGAGAGTAGCC
JMFF035C05+ CGGGGTATGTTAGAGAGTAGCC
                      ____________________________________________________________
consensus CCGGTTCTTGTTTTCCGGAAGCGGCGGCAGCTTTCGGGCGGGGTATGTTAGAGAGTAGCC
 
. : . : . : . : . : . :
JMFF045K03+ GGAAAAGGAGTCTTCTTCCACGAAATGCGACAGCCATTCAAGGCTATCCAAATCATCCGC
JMFS051B01+ GGAAAAGGAGTCTTCTTCCACGAAATGCGACAGCCATTCAAGGCTATCCAAATCATCCGC
JMFF035C05+ GGAAAAGGAGTCTTNTTCCACGAAATGCGACAGCCATTCAAGGCTATCCAAATCATCCGC
                      ____________________________________________________________
consensus GGAAAAGGAGTCTTCTTCCACGAAATGCGACAGCCATTCAAGGCTATCCAAATCATCCGC
 
. : . : . : . : . : . :
JMFF045K03+ CGGAGCATTGAGCCCGCCGCCGGGAAAACAAGAAAAATC-TTCTTCAATACAAAAATTAA
JMFS051B01+ CGGAGCATTGAGCCCGCCGCCGGGAAAACAAGAAAAATC-TTCTTCAATACAAAAATTAA
JMFF035C05+ CGGAGCATTGAGCCCGCCGCCGGGAAAACAAGAAAAATCTTTCTTCAATACAAAAATTAA
JMFF046F20+ CAATACAAAAATTAA
JMFF014G23+ TTCAATACAAAAATTAA
                      ____________________________________________________________
consensus CGGAGCATTGAGCCCGCCGCCGGGAAAACAAGAAAAATC-TTCTTCAATACAAAAATTAA
 
. : . : . : . : . : . :
JMFF045K03+ CGCCCACCGCTTCTTCTTGCCGCTTTTCCGGCATAACAGAGACAAACACCAAAGACCCAG
JMFS051B01+ CGCCCACCGCTTCTTCTTGCCGCTTTTCCGGCATAACAGAGACAAACACCAAAGACCCAG
JMFF035C05+ CGCCCACCGCTTCTTCTTGCCGCTTTTCCGGCATAACAGAGACAAACACCAAAGACCCAG
JMFF046F20+ CGCCCACCGCTTCTTCTTGCCGCTTTTCCGGCATAACAGAGACAAACACCAAAGACCCAG
JMFF014G23+ CGCCCACCGCTTNTTCTTGCCGCTTTTCCGGCATAACAGAGACAAACACCAAAGACCCAG
                      ____________________________________________________________
consensus CGCCCACCGCTTCTTCTTGCCGCTTTTCCGGCATAACAGAGACAAACACCAAAGACCCAG
 
. : . : . : . : . : . :
JMFF045K03+ AATTTCCTCCACCCTTCTCCTCCGGCACCTCTGTTTTCTCCTTCTCCTCGTACTCCTCGG
JMFS051B01+ AATTTCCTCCACCCTTCTCCTCCGGCACCTCTGTTTTCTCCTTCTCCTCGTACTCCTCGG
JMFF035C05+ AATTTCCTCCACCCTTCTCCTCCGGCACCTCTGTTTTCTCCTTCTCCTCGTACTCCTCGG
JMFF046F20+ AATTTCCTCCACCCTTCTCCTCCGGCACCTCTGTTTTCTCCTTCTCCTCGTACTCCTCGG
JMFF014G23+ AATTTCCTCCACCCTTCTCCTCCGGCACCTCTGTTTTCTCCTTCTCCTCGTACTCCTCGG
                      ____________________________________________________________
consensus AATTTCCTCCACCCTTCTCCTCCGGCACCTCTGTTTTCTCCTTCTCCTCGTACTCCTCGG
 
. : . : . : . : . : . :
JMFF045K03+ AAAACCCATTCGACAAGTCGAGGAGGTCGTCAACGAAGAAATCGTCGCCGCCGCCCCCTT
JMFS051B01+ AAAACCCATTCGACAAGTCGAGGAGGTCGTCAACGAAGAAATCGTCGCCGCCGCCCCCTT
JMFF035C05+ AAAACCCATTCGACAAGTCGAGGAGGTCGTCAACGAAGAAATCGTCGCCGCCGCCCCCTT
JMFF046F20+ AAAACCCATTCGACAAGTCGAGGAGGTCGTCAACGAAGAAATCGTCGCCGCCGCCCCCTT
JMFF014G23+ AAAACCCATTCGACAAGTCGAGGAGGTCGTCAACGAAGAAATCGTCGCCGCCGCCCCCTT
                      ____________________________________________________________
consensus AAAACCCATTCGACAAGTCGAGGAGGTCGTCAACGAAGAAATCGTCGCCGCCGCCCCCTT
 
. : . : . : . : . : . :
JMFF045K03+ GACAGCTCCCCACCGCCGGCAACTCATTTTCCAAACACCCCAGCGGGTGGGCCGTCTTCG
JMFS051B01+ GACAGCTCCCCACCGCCGGCAACTCATTTTCCAAACACCCCAGCGGGTGGGCCGTCTTCG
JMFF035C05+ GACAGCTCCCCACCGCCGGCAACTCATTTTCCAAACACCCCAGCGGGTGGGCCGTCTTCG
JMFF046F20+ GACAGCTCCCCACCGCCGGCAACTCATTTTCCAAACACCCCAGCGGGTGGGCCGTCTTCG
JMFF014G23+ GACAGCTCCCCACCGCCGGCAACTCATTTTCCAAACACCCCAGCGGGTGGGCCGTCTTCG
                      ____________________________________________________________
consensus GACAGCTCCCCACCGCCGGCAACTCATTTTCCAAACACCCCAGCGGGTGGGCCGTCTTCG
 
. : . : . : . : . : . :
JMFF045K03+ CCGCCATCTCCGGCCTAACAGAGCTCTTCAACGCGCACTCCATTCCCTGAACAGACACGG
JMFS051B01+ CCGCCATCTCCGGCCTAACAGAGCTCTTCAACGCGCACTCCATTCCCTGAACAGACACGG
JMFF035C05+ CCGCCATCTCCGGCCTAACAGAGCTCTTCAACGCGCACTCCATTCCCTGAACAGACACGG
JMFF046F20+ CCGCCATCTCCGGCCTAACAGAGCTCTTCAACGCGCACTCCATTCCCTGAACAGACACGG
JMFF014G23+ CCGCCATCTCCGGCCTAACAGAGCTCTTCAACGCGCACTCCATTCCCTGAACAGACACGG
                      ____________________________________________________________
consensus CCGCCATCTCCGGCCTAACAGAGCTCTTCAACGCGCACTCCATTCCCTGAACAGACACGG
 
. : . : . : . : . : . :
JMFF045K03+ CGGAGGACGGCGGCGGAGTTAGGGATAGGGCGGAGGAGGAGAAGGTAAAAGGGT
JMFS051B01+ CGGAGGACGGCGGCGGAGTTAGGGATAGGGCGGAGGAGGAGAAGGTAAAAGGGTTGAGAA
JMFF035C05+ CGGAGGACGGCGGCGGAGTTAGGGATAGGGCGGAGGAGGAGAAGGTAAAAGGGTTGAGAA
JMFF046F20+ CGGAGGACGGCGGCGGAGTTAGGGATAGGGCGGAGGAGGAGAAGGTAAAAGGGTTGAGAA
JMFF014G23+ CGGAGGACGGCGGCGGAGTTAGGGATAGGGCGGAGGAGGAGAAGGTAAAAGGGTTGAGAA
                      ____________________________________________________________
consensus CGGAGGACGGCGGCGGAGTTAGGGATAGGGCGGAGGAGGAGAAGGTAAAAGGGTTGAGAA
 
. : . : . : . : . : . :
JMFS051B01+ AAGAGTGGTGTTGAGTTCGGTAAAGCATTGAATGA
JMFF035C05+ AAGAGTGGTGTTGAGTTCGGTAAAGCATTGAATGA
JMFF046F20+ AAGAGTGGTGTTGAGTTCGGTAAAGCATTGAATGAGAGATAGATAGATAGAGAGACTCCC
JMFF014G23+ AAGAGTGGTGTTGAGTTCGGTAAAGCATTGAATGAGAGATAGATAGATAGAGAGACTCCC
                      ____________________________________________________________
consensus AAGAGTGGTGTTGAGTTCGGTAAAGCATTGAATGAGAGATAGATAGATAGAGAGACTCCC