Previous Contig 000744:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014F15Sequence601000744 (4)751004144 (3)gb:AP003350_18285462e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070
JMFS104H02Sequence565000744 (4)gb:AE005173_8926390.043Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC007915_153
JMFS139B05Sequence624000744 (4)
JMFS152E05Sequence627000744 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS104H02+ ATTAGCAGCCGCAACTGC
                      ____________________________________________________________
consensus ATTAGCAGCCGCAACTGC
 
. : . : . : . : . : . :
JMFS104H02+ AGGAGCAAAGGCTGAGGGTTGCTGACTGGTATGCTGCATAGGTGCACTCTGATTTGCAGG
JMFS139B05+ TGACTGGTATGCTGCATAGGTGCACTCTGATTTGCAGG
JMFS152E05+ TGACTGGTATGCTGCATAGGTGCACTCTGATTTGCAGG
JMFF014F15+ G
                      ____________________________________________________________
consensus AGGAGCAAAGGCTGAGGGTTGCTGACTGGTATGCTGCATAGGTGCACTCTGATTTGCAGG
 
. : . : . : . : . : . :
JMFS104H02+ TGGCACCCAGGGTTGTCCTCCAGCTGTGAATGCTGGTGTACTTATCTGGGATGACATGTT
JMFS139B05+ TGGCACCCAGGGTTGTCCTCCAGCTGTGAATGCTGGTGTACTTATCTGGGATGACATGTT
JMFS152E05+ TGGCACCCAGGGTTGTCCTCCAGCTGTGAATGCTGGTGTACTTATCTGGGATGACATGTT
JMFF014F15+ TGGCACCCAGGGTTGTCCTACAGCTGTGAATGCTGGTGTACTTATCTGGGATGACATGTT
                      ____________________________________________________________
consensus TGGCACCCAGGGTTGTCCTCCAGCTGTGAATGCTGGTGTACTTATCTGGGATGACATGTT
 
. : . : . : . : . : . :
JMFS104H02+ GATGCCACTGTTTGTCTGGCCAAAAGAAGATGCTGCAAAACCAGGCATGTGATTATTCCC
JMFS139B05+ GATGCCACTGTTTGTCTGGCCAAAAGAAGATGCTGCAAAACCAGGCATGTGATTATTCCC
JMFS152E05+ GATGCCACTGTTTGTCTGGCCAAAAGAAGATGCTGCAAA--CAGGCATGTGATTATTCCC
JMFF014F15+ GATGCCACTGTTTGTCTGGCCAAAAGAAGATGCTGCAAAACCAGGCATGTGATTATTCCC
                      ____________________________________________________________
consensus GATGCCACTGTTTGTCTGGCCAAAAGAAGATGCTGCAAAACCAGGCATGTGATTATTCCC
 
. : . : . : . : . : . :
JMFS104H02+ AGAAGGAATCATTTGTTGAGGCTGCATTGACGCAGATGGAATAGGCATATTTGGTTGCAT
JMFS139B05+ AGAAGGAATCATTTGTTGAGGCTGCATTGACGCAGATGGAATAGGCATATTTGGTTGCAT
JMFS152E05+ AGAAGGAATCATTTGTTGAGGCTGCATTGACGCAGATGGAATAGGCATATTTGGTTGCAT
JMFF014F15+ AGAAGGAATCATTTGTTGAGGCTGCATTGACGCAGATGGAATAGGCATATTTGGTTGCAT
                      ____________________________________________________________
consensus AGAAGGAATCATTTGTTGAGGCTGCATTGACGCAGATGGAATAGGCATATTTGGTTGCAT
 
. : . : . : . : . : . :
JMFS104H02+ CTGAATTGGCTGGGATGAAGGTATGTGACCAGGGCGTGGAGGAAAATGCTGCATTGGTTG
JMFS139B05+ CTGAATTGGCTGGGATGAAGGTATGTGACCAGGGCGTGGAGGAAAATGCTGCATTGGTTG
JMFS152E05+ CTGAATTGGCTGGGATGAAGGTATGTGACCAGGGCGTGGAGGAAAATGCTGCATTGGTTG
JMFF014F15+ CTGAATTGGCTGGGATGAAGGTATGTGACCAGGGCGTGGAGGAAAATGCTGCATTGGTTG
                      ____________________________________________________________
consensus CTGAATTGGCTGGGATGAAGGTATGTGACCAGGGCGTGGAGGAAAATGCTGCATTGGTTG
 
. : . : . : . : . : . :
JMFS104H02+ AGAAAATTGCATTGCTTGACTTTGTCCAGGACCCATACCAATGTTTGGCATTTGTACAGG
JMFS139B05+ AGAAAATTGCATTGCTTGACTTTGTCCAGGACCCATACCAATGTTTGGCATTTGTACAGG
JMFS152E05+ AGAAAATTGCATTGCTTGACTTTGTCCAGGACCCATACCAATGTTTGGCATTTGTACAGG
JMFF014F15+ AGAAAATTGCATTGCTTGACTTTGTCCAGGACCCATACCAATGTTTGGCATTTGTACAGG
                      ____________________________________________________________
consensus AGAAAATTGCATTGCTTGACTTTGTCCAGGACCCATACCAATGTTTGGCATTTGTACAGG
 
. : . : . : . : . : . :
JMFS104H02+ TGGAGCAAACGGCTGTCCTTGTTGTGCAGGTGCTCCAGGTTGAAATTGCATGGGAAACGA
JMFS139B05+ TGGAGCAAACGGCTGTCCTTGTTGTGCAGGTGCTCCAGGTTGAAATTGCATGGGAAACGA
JMFS152E05+ TGGAGCAAACGGCTGTCCTTGTTGTGCAGGTGCTCCAGGTTGAAATTGCATGGGAAACGA
JMFF014F15+ TGGAGCAAACGGCTGTCCTTGTTGTGCAGGTGCTCCAGGTTGAAATTGCATGGGAAACGA
                      ____________________________________________________________
consensus TGGAGCAAACGGCTGTCCTTGTTGTGCAGGTGCTCCAGGTTGAAATTGCATGGGAAACGA
 
. : . : . : . : . : . :
JMFS104H02+ ACCATAACCATGGGGCGCCATGGGTCCACCTGGATGTGGCCGAAGAGGCTGTGCACCAGA
JMFS139B05+ ACCATAACCATGGGGCGCCATGGGTCCACCTGGATGTGGCCGAAGAGGCTGTGCACCAGA
JMFS152E05+ ACCATAACCATGGGGCGCCATGGGTCCACCTGGATGTGGCCGAAGAGGCTGTGCACCAGA
JMFF014F15+ ACCATAACCATGGGGCGCCATGGGTCCACCTGGATGTGGCCGAAGAGGCTGTGCACCAGA
                      ____________________________________________________________
consensus ACCATAACCATGGGGCGCCATGGGTCCACCTGGATGTGGCCGAAGAGGCTGTGCACCAGA
 
. : . : . : . : . : . :
JMFS104H02+ TGGCGGTGGATTAGTTGCCATGCCAGCACATACACAATACTTCAACTTCCCAACAAGGCA
JMFS139B05+ TGGCGGTGGATTAGTTGCCATGCCAGCACATACACAATACTTCAACTTCCCAACAAGGCA
JMFS152E05+ TGGCGGTGGATTAGTTGCCATGCCAGCACATACACAATACTTCAACTTCCCAACAAGGCA
JMFF014F15+ TGGCGGTGGATTAGTTGCCATGCCAGCACATACACAATACTTCAACTTCCCAACAAGGCA
                      ____________________________________________________________
consensus TGGCGGTGGATTAGTTGCCATGCCAGCACATACACAATACTTCAACTTCCCAACAAGGCA
 
. : . : . : . : . : . :
JMFS104H02+ GCCTGAA
JMFS139B05+ GCCTGAACTGAAGAAAGATCGCCCGCGAAGGTTTATACAGATTGGTTTCTAAAAGCGGTG
JMFS152E05+ GCCTGAACTGAAGAAAGATCGCCCGCGAAGGTTTATACAGATTGGTTTCTAAAAGCGGTG
JMFF014F15+ GCCTGAACTGAAGAAAGATCGCCCGCGAAGGTTTATACAGATTGGTTTCTAAAAGCGGTG
                      ____________________________________________________________
consensus GCCTGAACTGAAGAAAGATCGCCCGCGAAGGTTTATACAGATTGGTTTCTAAAAGCGGTG
 
. : . : . : . : . : . :
JMFS139B05+ TTTTCTGGGAGCAGGGGAGTTTGATAGATTTCAGAACGTGTAATGT
JMFS152E05+ TTTTCTGGGAGCAGGGGAGTTTGATAGATTTCAGAACGTGTAATGT
JMFF014F15+ TTTTCTGGGAGCAGGGGAGTTTGATAGATTTCAGAACGTGTAATGTGAAGTGTAAACCAT
                      ____________________________________________________________
consensus TTTTCTGGGAGCAGGGGAGTTTGATAGATTTCAGAACGTGTAATGTGAAGTGTAAACCAT