Previous Contig 000742:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014F07Sequence606000742 (3)gb:AE005172_8908951e-35Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025808_153955747009502 (3)gb:AP003985_1835947e-102Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMFF027H11Sequence201000742 (3)pir|B96781|B967816e-06unknown protein F9E10.4 [imported] - Arabidopsis thaliana>gb:AE005173_895052 Ara756009502 (3)gb:AP003985_18359471e-83Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMSF011I21Sequence281000742 (3)gb:AE005172_8908952e-14Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025808_153955767009502 (3)gb:AP003985_18359474e-95Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014F07+ TCATCA
                      ____________________________________________________________
consensus TCATCA
 
. : . : . : . : . : . :
JMFF014F07+ GGAATGACAAGAGGATTAGTTCTCAGACTCTTGACAGTACCAAAAGGCCCAGCTTTTTGC
                      ____________________________________________________________
consensus GGAATGACAAGAGGATTAGTTCTCAGACTCTTGACAGTACCAAAAGGCCCAGCTTTTTGC
 
. : . : . : . : . : . :
JMFF014F07+ GGTTTATCCAACACCACAATTTGCTGCTCTACATTACCCTTTTGCTGCTCCGCTAGCCGT
                      ____________________________________________________________
consensus GGTTTATCCAACACCACAATTTGCTGCTCTACATTACCCTTTTGCTGCTCCGCTAGCCGT
 
. : . : . : . : . : . :
JMSF011I21+ TGTCAGACAACTTC
JMFF014F07+ AGCTTTTCAGTTAGCCCCCGCACCTGCTTCTGCAACTCACCATTCCTGTCAGACAACTTC
                      ____________________________________________________________
consensus AGCTTTTCAGTTAGCCCCCGCACCTGCTTCTGCAACTCACCATTCCTGTCAGACAACTTC
 
. : . : . : . : . : . :
JMSF011I21+ ATGATCTCCGATTTCAACATGTTTACCCGCTCAGAAGATTCACACGAGGAAGAGTCGCCC
JMFF014F07+ ATGATCTCCGATTTCAACATGTTTACCCGCTCAGAAGATTCACACGAGGAAGAGTCGCCC
                      ____________________________________________________________
consensus ATGATCTCCGATTTCAACATGTTTACCCGCTCAGAAGATTCACACGAGGAAGAGTCGCCC
 
. : . : . : . : . : . :
JMSF011I21+ TGAAGATTCAATTTGGAGAGTTTGCGAGTCTGGGTCTGCGGCGGATTGGATGAGAAGAAT
JMFF027H11+ TGGATGAGAAGAAT
JMFF014F07+ TGAAGATTCAATTTGGAGAGTTTGCGAGTCTGGGTCTGCGGCGGATTGGATGAGAAGAAT
                      ____________________________________________________________
consensus TGAAGATTCAATTTGGAGAGTTTGCGAGTCTGGGTCTGCGGCGGATTGGATGAGAAGAAT
 
. : . : . : . : . : . :
JMSF011I21+ CCATTAGGGTAGAGGAAAGCGAAGACGCAACCCATCAGAACTCCGAAAGCTATCGCGGCC
JMFF027H11+ CCATTAGGGTAGAGGAAAGCGAAGACGCAACCCATCAGAACTCCGAAAGCTATCGCGGCC
JMFF014F07+ CCATTAGGGTAGAGGAAAGCGAAGACGCAACCCATCAGAACTCCGAAAGCTATCGCGGCC
                      ____________________________________________________________
consensus CCATTAGGGTAGAGGAAAGCGAAGACGCAACCCATCAGAACTCCGAAAGCTATCGCGGCC
 
. : . : . : . : . : . :
JMSF011I21+ CCGATTCGAGATCCGCGTGTAGATTGGCCGGATTTCTCTCTCCGACCAGCCATGTTTCCT
JMFF027H11+ CCGATTCGAGATCCGCGTGTAGATTGGCCGGATTTCTCTCTCCGACCAGCCATGTTTCCT
JMFF014F07+ CCGATTCGAGATCCGCGTGTAGATTGGCCGGATTTCCCTCTCCGACCAGCCATGTTTCCT
                      ____________________________________________________________
consensus CCGATTCGAGATCCGCGTGTAGATTGGCCGGATTTCTCTCTCCGACCAGCCATGTTTCCT
 
. : . : . : . : . : . :
JMSF011I21+ CCTCTCTTACAAGAAAACTTTCCTC
JMFF027H11+ CCTCTCTTACAAGAAAACTTTCCTCTCTTATTTCTCCCAAAGACAGGAAAAAATCTTTCT
JMFF014F07+ CCTCTCTTACAAGAAAACTTTCCTCTCTTATTTCTCCCAAAGACAGGAAAAAATCTTTCT
                      ____________________________________________________________
consensus CCTCTCTTACAAGAAAACTTTCCTCTCTTATTTCTCCCAAAGACAGGAAAAAATCTTTCT
 
. : . : . : . : . : . :
JMFF027H11+ AGACCAT
JMFF014F07+ AGACCATGAAGTGAAGATTACTCCACTTTGCAAAGAAGGAAATAAAAATCCAAACTTGAA
                      ____________________________________________________________
consensus AGACCATGAAGTGAAGATTACTCCACTTTGCAAAGAAGGAAATAAAAATCCAAACTTGAA
 
. : . : . : . : . : . :
JMFF014F07+ TACGTTCTTGACTTTTGGTTCTAAAAGCTCTGTCCCGATCGTATTTATTATATATATATC
                      ____________________________________________________________
consensus TACGTTCTTGACTTTTGGTTCTAAAAGCTCTGTCCCGATCGTATTTATTATATATATATC