Previous Contig 000734:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014B20Sequence573000734 (2)pir|B84684|B846849e-53hypothetical protein At2g28380 [imported] - Arabidopsis thaliana>gb:AC006283_153599020965gb:AF159297_17732210.003Zea mays pollen extensin-like protein (Pex2) gene, complete cds.
JMFF036M24Sequence553000734 (2)pir|B84684|B846845e-53hypothetical protein At2g28380 [imported] - Arabidopsis thaliana>gb:AC006283_153673021506sp|Q9PU36|PCLO_CHICK7e-04Piccolo protein (Aczonin) (Fragment).>gb:GGY19187_2573869 Gallus gallus mRNA for

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036M24+ GATCTGAATGTAGTGTATGCCGGCAATGATGCTCCT
                      ____________________________________________________________
consensus GATCTGAATGTAGTGTATGCCGGCAATGATGCTCCT
 
. : . : . : . : . : . :
JMFF036M24+ ACTCTTTGAGAAACCTCTTGCAAGAGATTCTTGTATACTCCTGTCTCATCCAAAATTCTG
                      ____________________________________________________________
consensus ACTCTTTGAGAAACCTCTTGCAAGAGATTCTTGTATACTCCTGTCTCATCCAAAATTCTG
 
. : . : . : . : . : . :
JMFF036M24+ GCGGCAAGAGAATTGGAAGGTCCACGGTTGGCGAGAGCATTGAGCGCCACCTCAGCTGCG
                      ____________________________________________________________
consensus GCGGCAAGAGAATTGGAAGGTCCACGGTTGGCGAGAGCATTGAGCGCCACCTCAGCTGCG
 
. : . : . : . : . : . :
JMFF036M24+ GAGTGCTCAGCCTGGCGAAGCGTGGAGCAGTAATGGGGGCTCTCGAAGGTCTCGCCGTTG
JMFF014B20+ GTGGAGCAGTAGTTAGGGCTCTCGAACGTCTCGCCGTTG
                      ____________________________________________________________
consensus GAGTGCTCAGCCTGGCGAAGCGTGGAGCAGTAGTTGGGGCTCTCGAAGGTCTCGCCGTTG
 
. : . : . : . : . : . :
JMFF036M24+ AAGTTCACCGTGGCCTTGAATCGGGGCCCGTGATCCGGGCCTTCTCTGATGCAACTATAC
JMFF014B20+ AAGTTCACGGTCGCCTTGAATCGCGGCGCGTGATCAGGACCTTCTCTGATGCAGGAATAC
                      ____________________________________________________________
consensus AAGTTCACGGTGGCCTTGAATCGGGGCGCGTGATCCGGGCCTTCTCTGATGCAGGTATAC
 
. : . : . : . : . : . :
JMFF036M24+ GACGGCAGGTTGAAGCAGCTCCTCTGCGCCAGTTCCTGCAGCTGGTTCTTATACATTTCT
JMFF014B20+ GACGGCAAGTTGAAGCAGCTCCTCTGCGCCAGCTCCTGCAGCTGGTTCTTATACATTTCT
                      ____________________________________________________________
consensus GACGGCAGGTTGAAGCAGCTCCTCTGCGCCAGTTCCTGCAGCTGGTTCTTATACATTTCT
 
. : . : . : . : . : . :
JMFF036M24+ CC
JMFF014B20+ CCCTACCACAACCAAACCCTTCCAAACCTTCAAAAGCGAGAAATCAAACGGAAAACAATC
                      ____________________________________________________________
consensus CCCTACCACAACCAAACCCTTCCAAACCTTCAAAAGCGAGAAATCAAACGGAAAACAATC
 
. : . : . : . : . : . :
JMFF014B20+ AGCTCAGATCATCACGGCCGACACCAGCTCCGATCGGAGGGTTTCTAGACAGAGAAAGTA
                      ____________________________________________________________
consensus AGCTCAGATCATCACGGCCGACACCAGCTCCGATCGGAGGGTTTCTAGACAGAGAAAGTA
 
. : . : . : . : . : . :
JMFF014B20+ ACATCGGAGCAAATGGCCGGCAGAGAGAGAGAGAGATTGGAGCTTCGTAGCAGAGAAGAG
                      ____________________________________________________________
consensus ACATCGGAGCAAATGGCCGGCAGAGAGAGAGAGAGATTGGAGCTTCGTAGCAGAGAAGAG
 
. : . : . : . : . : . :
JMFF014B20+ AAAGAGAGAGCGGGTGAGGGATTCTACTCTCTCGGCATCAGAAACAACGAAGGAGAGTGT
                      ____________________________________________________________
consensus AAAGAGAGAGCGGGTGAGGGATTCTACTCTCTCGGCATCAGAAACAACGAAGGAGAGTGT