Previous Contig 000730:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014A05Sequence531000730 (3)760012256 (2)gb:AY084533_15696226e-60Arabidopsis thaliana clone 111031 mRNA, complete sequence.>gb:BT001920_1635523 A
JMFS035E02Sequence641000730 (3)gb:AP004585_18418863e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P047
JMFS040G09Sequence354000730 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS035E02+ GGTCATGATCATGAGAATGGACCGCA
                      ____________________________________________________________
consensus GGTCATGATCATGAGAATGGACCGCA
 
. : . : . : . : . : . :
JMFS035E02+ TGGCTTTCTGAATGAGAGTGATTGTCACCAAAAGCATGGGGTAGTTGATGAAGAAAAGCA
                      ____________________________________________________________
consensus TGGCTTTCTGAATGAGAGTGATTGTCACCAAAAGCATGGGGTAGTTGATGAAGAAAAGCA
 
. : . : . : . : . : . :
JMFS035E02+ TCACCCAACATTGCTCCAGCCCCAAATAATGCCAGAGCATCCACAATGGCTTTGGATGGC
                      ____________________________________________________________
consensus TCACCCAACATTGCTCCAGCCCCAAATAATGCCAGAGCATCCACAATGGCTTTGGATGGC
 
. : . : . : . : . : . :
JMFS035E02+ CTTCCTTTCAAAAATATTAGAGGCAATATGATCAGGCAAACAAGGGATGCCAAGCTCACC
                      ____________________________________________________________
consensus CTTCCTTTCAAAAATATTAGAGGCAATATGATCAGGCAAACAAGGGATGCCAAGCTCACC
 
. : . : . : . : . : . :
JMFS035E02+ AATAGAGAGCAACTCATTGCATGAAGCCAAAGCCCAAGACCAGAGAACTCAGAATCAACA
                      ____________________________________________________________
consensus AATAGAGAGCAACTCATTGCATGAAGCCAAAGCCCAAGACCAGAGAACTCAGAATCAACA
 
. : . : . : . : . : . :
JMFS035E02+ TGCCCGTGGTCATGATGGTGGTGGTGGTGTTCATCGCGGGTCCCAAATCCGTACAGCTTT
                      ____________________________________________________________
consensus TGCCCGTGGTCATGATGGTGGTGGTGGTGTTCATCGCGGGTCCCAAATCCGTACAGCTTT
 
. : . : . : . : . : . :
JMFS035E02+ AGATCTTCCTCTTCCGCCAATTCCTCAGGAAGCAGCTTCCTTTTATTCACTTCAGCGCCG
JMFS040G09+ CAGCGCCG
JMFF014A05+ TCTTCCGCCAATTCCTCAGGAAGCAGCTTCCTTTTATTCACTTCAGCGCCG
                      ____________________________________________________________
consensus AGATCTTCCTCTTCCGCCAATTCCTCAGGAAGCAGCTTCCTTTTATTCACTTCAGCGCCG
 
. : . : . : . : . : . :
JMFS035E02+ CTATGGTGGTGGTGGTGATCGTGATCGTGGCCGTGGCTACACTGGTGAGTAGACGCGTGT
JMFS040G09+ CTATGGTGGTGGTGGTGATCGTGATCGTGGCCGTGGCTACACTGGTGAGTAGACGCGTGT
JMFF014A05+ CTATGGTGGTGGTGGTGATCGTGATCGTGGCCGTGGCTACACTGGTGAGTAGACGCGTGT
                      ____________________________________________________________
consensus CTATGGTGGTGGTGGTGATCGTGATCGTGGCCGTGGCTACACTGGTGAGTAGACGCGTGT
 
. : . : . : . : . : . :
JMFS035E02+ CCATGGTCAGCATCGCCGTGGTGATGGTCGTGTCCGTGGCTACACTGTTCCGGCGAAGAA
JMFS040G09+ CCATGGTCAGCATCGCCGTGGTGATGGTCGTGTCCGTGGCTACACTGTTCCGGCGAAGAA
JMFF014A05+ CCATGGTCAGCATCGCCGTGGTGATGGTCGTGTCCGTGGCTACACTGTTCCGGCGAAGAA
                      ____________________________________________________________
consensus CCATGGTCAGCATCGCCGTGGTGATGGTCGTGTCCGTGGCTACACTGTTCCGGCGAAGAA
 
. : . : . : . : . : . :
JMFS035E02+ TGCCCGTGGACCGCCGACACACACAATCCAGAAATCAGCAGTAAGACAAACAGTAAACCG
JMFS040G09+ TGCCCGTGGACCGCCGACACACACAATCCAGAAATCAGCAGTAAGACAAACAGTAAACCG
JMFF014A05+ TGCCCGTGGACCGCCGACACACACAATCCAGAAATCAGCAGTAAGACAAACAGTAAACCG
                      ____________________________________________________________
consensus TGCCCGTGGACCGCCGACACACACAATCCAGAAATCAGCAGTAAGACAAACAGTAAACCG
 
. : . : . : . : . : . :
JMFS035E02+ GGGCAGATCTGTCTTAGAGCAACCGCCATTTCTGCTTCTCCTTCTAAGATGAGTACGGCG
JMFS040G09+ GGGCAGATCTGTCTTAGAGCAACCGCCATTTCTGCTTCTCCTTCTAAGATGAGTACGGCG
JMFF014A05+ GGGCAGATCTGTCTTAGAGCAACCGCCATTTCTGCTTCTCCTTCTAAGATGAGTACGGCG
                      ____________________________________________________________
consensus GGGCAGATCTGTCTTAGAGCAACCGCCATTTCTGCTTCTCCTTCTAAGATGAGTACGGCG
 
. : . : . : . : . : . :
JMFS035E02+ GAGTAGACGACTTCG
JMFS040G09+ GAGTAGACGACTTCGCCACTTGGGAAAATTAAATTTGAACCCCTTAAAAAAAAATCTAAT
JMFF014A05+ GAGTAGACGACTTCGCCACTTGGGAAAATTAAATTTGAACCCCTCAAAAAAAAATCTAAT
                      ____________________________________________________________
consensus GAGTAGACGACTTCGCCACTTGGGAAAATTAAATTTGAACCCCTTAAAAAAAAATCTAAT
 
. : . : . : . : . : . :
JMFS040G09+ TTTAGGAAGCGAATTTAGAGTGGGGAGAGCTAATG
JMFF014A05+ TTTAGGAAGCGAATTTAGAGTGGGGAGAGCTAATGTGGAAGTGGATGAAGAACATTAAAT
                      ____________________________________________________________
consensus TTTAGGAAGCGAATTTAGAGTGGGGAGAGCTAATGTGGAAGTGGATGAAGAACATTAAAT
 
. : . : . : . : . : . :
JMFF014A05+ TGGGATTTGAAACAATCAGAGGAATTAAGAGCGGTTTTTGCAGGTGCCTTCAATTGTGAT
                      ____________________________________________________________
consensus TGGGATTTGAAACAATCAGAGGAATTAAGAGCGGTTTTTGCAGGTGCCTTCAATTGTGAT
 
. : . : . : . : . : . :
JMFF014A05+ TATACAAACGGCGCAGAAGAAGAGTATAATTATTCCCACGATTACACCGAATGTTACCAC
                      ____________________________________________________________
consensus TATACAAACGGCGCAGAAGAAGAGTATAATTATTCCCACGATTACACCGAATGTTACCAC