Previous Contig 000721:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013M12Sequence548000721 (2)gb:AP003631_18317798e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058
JMFS056G12Sequence613000721 (2)gb:AP003631_18317792e-95Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P058

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS056G12+ TGTGAGCTTCCTTAGGAACTNTGCTGGATTTCCACCCCAGACCTCTCC
                      ____________________________________________________________
consensus TGTGAGCTTCCTTAGGAACTNTGCTGGATTTCCACCCCAGACCTCTCC
 
. : . : . : . : . : . :
JMFS056G12+ ACATGGAATGCGTGTATTCTGTCTCACAAGGGCACCAGCAGCAACCATGGCATTTTTCTC
                      ____________________________________________________________
consensus ACATGGAATGCGTGTATTCTGTCTCACAAGGGCACCAGCAGCAACCATGGCATTTTTCTC
 
. : . : . : . : . : . :
JMFS056G12+ AACAACCACCCCATCAAGCAATGTTGCACCCATACCAACAAACGCCTCGTCTTCAACAGT
                      ____________________________________________________________
consensus AACAACCACCCCATCAAGCAATGTTGCACCCATACCAACAAACGCCTCGTCTTCAACAGT
 
. : . : . : . : . : . :
JMFS056G12+ ACACCCATGCAGGACCGCACTATGACCAACAGTAACATTGTTGCCAATGACCGTTGACAA
JMFF013M12+ GCACTATGACCAACAGTAACATTGTTGCCAATGACCGTTGACAA
                      ____________________________________________________________
consensus ACACCCATGCAGGACCGCACTATGACCAACAGTAACATTGTTGCCAATGACCGTTGACAA
 
. : . : . : . : . : . :
JMFS056G12+ AACCTTTCCAGCTAGATTGGATTTGGCTACATGAACAAGAGAATTGTCCTGAATATTGGT
JMFF013M12+ AACCTTTCCAGCTAGATTGGATTTGGCTACATGAACAAGAGAATTGTCCTGAATATTGGT
                      ____________________________________________________________
consensus AACCTTTCCAGCTAGATTGGATTTGGCTACATGAACAAGAGAATTGTCCTGAATATTGGT
 
. : . : . : . : . : . :
JMFS056G12+ TCCTGCCCCTATACTTATACTGTTCACATCACCTCGCAGAACACATCCATACCAGATAGA
JMFF013M12+ TCCTGCCCCTATACTTATACTGTTCACATCACCTCGCAGAACACATCCATACCAGATAGA
                      ____________________________________________________________
consensus TCCTGCCCCTATACTTATACTGTTCACATCACCTCGCAGAACACATCCATACCAGATAGA
 
. : . : . : . : . : . :
JMFS056G12+ GGAATTGCGCCCAACTTGAACATCCCCAATGATAGAAGCACTTGGGGCAACAAATGCTTC
JMFF013M12+ GGAATTGCGCCCAACTTGAACATCCCCAATGATAGAAGCACTTGGGGCAACAAATGCTTC
                      ____________________________________________________________
consensus GGAATTGCGCCCAACTTGAACATCCCCAATGATAGAAGCACTTGGGGCAACAAATGCTTC
 
. : . : . : . : . : . :
JMFS056G12+ TCTATGAACAGCAGGAGCTTTGTCGAACAAGTTCATAAGAGTTCTATGCCTAGACAGTTG
JMFF013M12+ TCTATGAACAGCAGGAGCTTTGTCGAACAAGTTCATAAGAGTTCTATGCCTAGACAGTTG
                      ____________________________________________________________
consensus TCTATGAACAGCAGGAGCTTTGTCGAACAAGTTCATAAGAGTTCTATGCCTAGACAGTTG
 
. : . : . : . : . : . :
JMFS056G12+ TTCATGGAAGTAGTAGTTGCCCTGGAGGCGGCAGCCCAGGCGATCGAGGGCTTGACCCGT
JMFF013M12+ TTCATGGAAGTAGTAGTTGCCCTGGAGGCGGCAGCCCAGGCGATCGAGGGCTTGACCCGT
                      ____________________________________________________________
consensus TTCATGGAAGTAGTAGTTGCCCTGGAGGCGGCAGCCCAGGCGATCGAGGGCTTGACCCGT
 
. : . : . : . : . : . :
JMFS056G12+ TTCGCGGATCCAGAATCCGACGGTGTAGATTGCTTTCCCAAGCGAACCCATCTTCTTC
JMFF013M12+ TTCGCGGATCCAGAATCCGACGGTGTAGATTGCTTTCCCAAGCGAACCCATCTTCTTCGG
                      ____________________________________________________________
consensus TTCGCGGATCCAGAATCCGACGGTGTAGATTGCTTTCCCAAGCGAACCCATCTTCTTCGG
 
. : . : . : . : . : . :
JMFF013M12+ CTTCTTCCTCTAGTACTCCGTTCCAGAATTGCTACGAAGTGTAATGATTTTTGGGGGAGA
                      ____________________________________________________________
consensus CTTCTTCCTCTAGTACTCCGTTCCAGAATTGCTACGAAGTGTAATGATTTTTGGGGGAGA
 
. : . : . : . : . : . :
JMFF013M12+ AGAGAGTGTGGATACCACAAGGTGTGAGAGAAAATGCGGTGAGCTGAACTGGAATAGTAC
                      ____________________________________________________________
consensus AGAGAGTGTGGATACCACAAGGTGTGAGAGAAAATGCGGTGAGCTGAACTGGAATAGTAC