Previous Contig 000714:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013J22Sequence615000714 (2)gb:AB020742_15145683e-30Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:AY064067_156736008827 (2)gb:AY742300_11799243e-31Malus x domestica anthranilate N-hydroxycinnamoyl/benzoyltransferase mRNA, parti
JMFF035J09Sequence569000714 (2)gb:AB020742_15145684e-27Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:AY064067_156732008827 (2)gb:AY742300_11799243e-31Malus x domestica anthranilate N-hydroxycinnamoyl/benzoyltransferase mRNA, parti

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF013J22+ TCAGCCCAGGAGTTA
                      ____________________________________________________________
consensus TCAGCCCAGGAGTTA
 
. : . : . : . : . : . :
JMFF035J09+ AGGCTGTGA-TTCAATGTGCAGGCGATGAA
JMFF013J22+ AAGAAATTCCAGAAGGAAGTGCCGTCTCCGAGGCTGTGATTTCAATGTGCAGGCGATGAA
                      ____________________________________________________________
consensus AAGAAATTCCAGAAGGAAGTGCCGTCTCCGAGGCTGTGATTTCAATGTGCAGGCGATGAA
 
. : . : . : . : . : . :
JMFF035J09+ GTAGCCATCGAGAAGCTCAGTTATTTGCACCCCCATCAGAGGCTTGCAGATCCCGTCGCG
JMFF013J22+ GTAGCCATCGAGAAGCTCAGTTATTTGCACCCCCATCAGAGGCTTGCAGATCCCGTCGCG
                      ____________________________________________________________
consensus GTAGCCATCGAGAAGCTCAGTTATTTGCACCCCCATCAGAGGCTTGCAGATCCCGTCGCG
 
. : . : . : . : . : . :
JMFF035J09+ GTTGAGAATGCCATTGAGGGTGAAGAGAGATCGGAGTATCTGCGGCACATTAATGTTGGA
JMFF013J22+ GTTGAGAATGCCATTGAGGGTGAAGAGAGATCGGAGTATCTGCGGCACATTAATGTTGGA
                      ____________________________________________________________
consensus GTTGAGAATGCCATTGAGGGTGAAGAGAGATCGGAGTATCTGCGGCACATTAATGTTGGA
 
. : . : . : . : . : . :
JMFF035J09+ CTGATCAAGAATTGCAGCCACCGTGACGCCACTAGCCTTGGCTTCTACAAACTCAACACC
JMFF013J22+ CTGATCAAGAATTGCAGCCACCGTGACGCCACTAGCCTTGGCTTCTACAAACTCAACACC
                      ____________________________________________________________
consensus CTGATCAAGAATTGCAGCCACCGTGACGCCACTAGCCTTGGCTTCTACAAACTCAACACC
 
. : . : . : . : . : . :
JMFF035J09+ TGCATTGTTACAATCAACATAAACACTACAAGTGTTGTCCTCTTCATTCATCACCGTGGC
JMFF013J22+ TGCATTGTTACAATCAACATAAACACTACAAGTGTTGTCCTCTTCATTCATCACCGTGGC
                      ____________________________________________________________
consensus TGCATTGTTACAATCAACATAAACACTACAAGTGTTGTCCTCTTCATTCATCACCGTGGC
 
. : . : . : . : . : . :
JMFF035J09+ AAAGCGGCCGGCAAGCGGAGGAAAGAAATCCAGTGTGGAGGAGAGAGAAGTTTTCAAGTG
JMFF013J22+ AAAGCGGCCGGCAAGCGGAGGAAAGAAATCCAGTGTGGAGGAGAGAGAAGTTTTCAAGTG
                      ____________________________________________________________
consensus AAAGCGGCCGGCAAGCGGAGGAAAGAAATCCAGTGTGGAGGAGAGAGAAGTTTTCAAGTG
 
. : . : . : . : . : . :
JMFF035J09+ ATGAATCAAATTGGAGTTGAAGAATTGTTGTTGCTGTTGAGGGGTGGGGTTGTGGAAGAG
JMFF013J22+ ATGAATCAAATTGGAGTTGAAGAATTGTTGTTGCTGTTGAGGGGTGGGGTTGTGGAAGAG
                      ____________________________________________________________
consensus ATGAATCAAATTGGAGTTGAAGAATTGTTGTTGCTGTTGAGGGGTGGGGTTGTGGAAGAG
 
. : . : . : . : . : . :
JMFF035J09+ AAGTCCTTTCTGGATGGGGCCAATTTGAAGGAACTGCAGATCCCATGGTGTTAACTCAAC
JMFF013J22+ AAGTCCTTTCTGGATGGGGCCAATTTGAAGGAACTGCAGATCCCATGGTGTTAACTCAAC
                      ____________________________________________________________
consensus AAGTCCTTTCTGGATGGGGCCAATTTGAAGGAACTGCAGATCCCATGGTGTTAACTCAAC
 
. : . : . : . : . : . :
JMFF035J09+ TCTTCTTGACACACCATTTGATCTTGCAGCGCCGGCAGCTCCAACGAAGCACTTGGATAT
JMFF013J22+ TCTTCTTGACACACCATTTGATCTTGCAGCGCCGGCAGCTCCAACGAAGCACTTGGATAT
                      ____________________________________________________________
consensus TCTTCTTGACACACCATTTGATCTTGCAGCGCCGGCAGCTCCAACGAAGCACTTGGATAT
 
. : . : . : . : . : . :
JMFF035J09+ GACTTCAACTTCTTCTCCCATTTCCGGTTCAACTCCTAAGTCCTAACCAAGCTCGACAGC
JMFF013J22+ GACTTCAACTTCTTCTCCCATTTCCGGTTCAACTCCTAAGTCCTAACCAAGCTCGACAGC
                      ____________________________________________________________
consensus GACTTCAACTTCTTCTCCCATTTCCGGTTCAACTCCTAAGTCCTAACCAAGCTCGACAGC