Previous Contig 000711:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013H22Sequence576000711 (6)gb:AY389717_11783309e-77Hyacinthus orientalis mago nashi-like protein mRNA, partial cds.719000711 (6)gb:AY389717_11783302e-76Hyacinthus orientalis mago nashi-like protein mRNA, partial cds.
JMFN011I04Sequence584000711 (6)gb:AY389717_11783301e-76Hyacinthus orientalis mago nashi-like protein mRNA, partial cds.
JMFN011N16Sequence555000711 (6)gb:AY389717_11783309e-77Hyacinthus orientalis mago nashi-like protein mRNA, partial cds.
JMFN038H04Sequence631000711 (6)gb:AY389717_11783301e-76Hyacinthus orientalis mago nashi-like protein mRNA, partial cds.
JMSF040O22Sequence529007107 (23)145000711 (6)gb:AY389717_11783306e-06Hyacinthus orientalis mago nashi-like protein mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013H22- GTAAATACCATGTCAAAGAACTGTGT
                      ____________________________________________________________
consensus GTAAATACCATGTCAAAGAACTGTGT
 
. : . : . : . : . : . :
rJMFF013H22- CGGAGTTAGGGATAGTTAAAGACATCACTTGTGAAAATGAAAGCAAGTTGGAAAACATAT
                      ____________________________________________________________
consensus CGGAGTTAGGGATAGTTAAAGACATCACTTGTGAAAATGAAAGCAAGTTGGAAAACATAT
 
. : . : . : . : . : . :
JMFN011N16+ CTGCCAAAACAAAGTGCGCAATA
JMFN011I04+ CTGCCAAAACAAAGTGCACAATA
rJMFF013H22- TTGATTACAAGCTAGACAGAGTCTAGAAGAAAATATGCTGCCAAAACAAAGTGCACAATA
JMFN038H04+ GCTAGACAGAGTCTAGAAGAAAATATGCTGCCAAAACAAAGTGCACAATA
                      ____________________________________________________________
consensus TTGATTACAAGCTAGACAGAGTCTAGAAGAAAATATGCTGCCAAAACAAAGTGCACAATA
 
. : . : . : . : . : . :
JMFN011N16+ GCAATCCAGTCTTCTCAATGCAAGCTGGAAGTAGAAAGCCAAACAAAAAAGGCCTCGTTT
JMFN011I04+ ACAATCCAGTCTTCTCAATGCAAGCTGGAAGTAGAAAGCCAAACAAAAAAAGCCTCGTTT
rJMFF013H22- ACAATCCAGTCTTCTCAATGCAAGCTGGAAGTAGAAAGCCAAACAAAAAAAGCCTCGTTT
JMFN038H04+ ACAATCCAGTCTTCTCAATGCAAGCTGGAAGTAGAAAGCCAAACAAAAAAAGCCTCGTTT
JMFF013H22+ CTGGAAGTAGAAAGCCAAACAAAAAAAGCNTCGTTT
                      ____________________________________________________________
consensus ACAATCCAGTCTTCTCAATGCAAGCTGGAAGTAGAAAGCCAAACAAAAAAAGCCTCGTTT
 
. : . : . : . : . : . :
JMFN011N16+ TAGCACCCGATGAGACCAATTTTATATTGGTTTGATTTTGAAGTGGAGGGAGATCAGCGA
JMFN011I04+ TAGCACCCGATGAGACCAATTTTATATTGGTTTGATTTTGAAGTGGAGGGAGATCAGCGA
rJMFF013H22- TAGCACCCGATGAGACCAATTTTATATTGGTTTGATTTTGAAGTGGAGGGAGATCAGCGA
JMFN038H04+ TAGCACCCGATGAGACCAATTTTATATTGGTTTGATTTTGAAGTGGAGGGAGATCAGCGA
JMFF013H22+ TAGCACCCGATGAGACCAATTTTATATTGGTTTGATTTTGAAGTGGAGGGAGATCAGCGA
                      ____________________________________________________________
consensus TAGCACCCGATGAGACCAATTTTATATTGGTTTGATTTTGAAGTGGAGGGAGATCAGCGA
 
. : . : . : . : . : . :
JMFN011N16+ GAACACAAAACACTTCAGATCCTGAACAAGATAATAAAAGATGCGAAGTCCTTCTGGATC
JMFN011I04+ GAACACAAAACACTTCAGATCCTGAACAAGATAATAAAAGATGCGAAGTCCTTCTGGATC
rJMFF013H22- GAACACAAAACACTTCAGATCCTGAACAAGATAATAAAAGATGCGAAGTCCTTCTGGATC
JMFN038H04+ GAACACAAAACACTTCAGATCCTGAACAAGATAATAAAAGATGCGAAGTCCTTCTGGATC
JMFF013H22+ GAACACAAAACACTTCAGATCCTGAACAAGATAATAAAAGATGCGAAGTCCTTCTGGATC
                      ____________________________________________________________
consensus GAACACAAAACACTTCAGATCCTGAACAAGATAATAAAAGATGCGAAGTCCTTCTGGATC
 
. : . : . : . : . : . :
JMFN011N16+ TTTACTGGTCTGCACGTCCATCAGAGAACCAATCTTAGACGTAGTAAAAGATATGTGCTC
JMFN011I04+ TTTACTGGTCTGCACGTCCATCAGAGAACCAATCTTAGACGTAGTAAAAGATATGTGCTC
rJMFF013H22- TTTACTGGTCTGCACGTCCATCAGAGAACCAATCTTAGACGTAGTAAAAGATATGTGCTC
JMFN038H04+ TTTACTGGTCTGCACGTCCATCAGAGAACCAATCTTAGACGTAGTAAAAGATATGTGCTC
JMFF013H22+ TTTACTGGTCTGCACGTCCATCAGAGAACCAATCTTAGACGTAGTAAAAGATATGTGCTC
                      ____________________________________________________________
consensus TTTACTGGTCTGCACGTCCATCAGAGAACCAATCTTAGACGTAGTAAAAGATATGTGCTC
 
. : . : . : . : . : . :
JMFN011N16+ ATTCCCCATCACAATCTCAAGCTCTTGTCGCCCCACACGGTCTGGTTCTGGCCAATTGTT
JMFN011I04+ ATTCCCCATCACAATCTCAAGCTCTTGTCGCCCCACACGGTCTGGTTCTGGCCAATTGTT
rJMFF013H22- ATTCCCCATCACAATCTCAAGCTCTTGTCGCCCCACACGGTCTGGTTCTGGCCAATTGTT
JMFN038H04+ ATTCCCCATCACAATCTCAAGCTCTTGTCGCCCCACACGGTCTGGTTCTGGCCAATTGTT
JMFF013H22+ ATTCCCCATCACAATCTCAAGCTCTTGTCGCCCCACACGGTCTGGTTCTGGCCAATTGTT
                      ____________________________________________________________
consensus ATTCCCCATCACAATCTCAAGCTCTTGTCGCCCCACACGGTCTGGTTCTGGCCAATTGTT
 
. : . : . : . : . : . :
JMFN011N16+ GTCATCTTCCTTCATGATCTCGCTATCGGCGACGATGCGGCGGCATTCTTTGAGAACGGC
JMFN011I04+ GTCATCTTCCTTCATGATCTCGCTATCGGCGACGATGCGGCGGCATTCTTTGAGAACGGC
rJMFF013H22- GTCATCTTCCTTCATGATCTCGCTATCGGCGACGATGCGGCGGCATTCTTTGAGAACGGC
JMFN038H04+ GTCATCTTCCTTCATGATCTCGCTATCGGCGACGATGCGGCGGCATTCTTTGAGAACGGC
JMFF013H22+ GTCATCTTCCTTCATGATCTCGCTATCGGCGACGATGCGGCGGCATTCTTTGAGAACGGC
                      ____________________________________________________________
consensus GTCATCTTCCTTCATGATCTCGCTATCGGCGACGATGCGGCGGCATTCTTTGAGAACGGC
 
. : . : . : . : . : . :
JMFN011N16+ AGGGGTGAGGAAGACTTCCTTACGAATCATGGTGTCGTTCTTGTAGTTGGAGTTGTTGGC
JMFN011I04+ AGGGGTGAGGAAGACTTCCTTACGAATCATGGTGTCGTTCTTGTAGTTGGAGTTGTTGGC
rJMFF013H22- AGGGGTGAGGAAGACTTCCTTACGAATCATGGTGTCGTTCTTGTAGTTGGAGTTGTTGGC
JMFN038H04+ AGGGGTGAGGAAGACTTCCTTACGAATCATGGTGTCGTTCTTGTAGTTGGAGTTGTTGGC
JMFF013H22+ AGGGGTGAGGAAGACTTCCTTACGAATCATGGTGTCGTTCTTGTAGTTGGAGTTGTTGGC
                      ____________________________________________________________
consensus AGGGGTGAGGAAGACTTCCTTACGAATCATGGTGTCGTTCTTGTAGTTGGAGTTGTTGGC
 
. : . : . : . : . : . :
JMFN011N16+ ATAGCGGAGCTTGCCGTCGGGTCGGAATTCAAACTCCAGAAACTCGTGCCCGAATTTTCC
JMFN011I04+ ATAGCGGAGCTTGCCGTCGGGTCGGAATTCAAACTCCAGAAACTCGTGCCCGAATTTTCC
rJMFF013H22- ATAGCGGAGCTTGCCGTCGGGTCGGAATTCAAACTCCAGAAACTCGTGCCCGAATTTTCC
JMFN038H04+ ATAGCGGAGCTTGCCGTCGGGTCGGAATTCAAACTCCAGAAACTCGTGCCCGAATTTTCC
rJMSF040O22- TCCAGAAACTCGTGCCCGAATTTTCC
JMFF013H22+ ATAGCGGAGCTTGCCGTCGGGTCGGAATTCAAACTCCAGAAACTCGTGCCCGAATTTTCC
                      ____________________________________________________________
consensus ATAGCGGAGCTTGCCGTCGGGTCGGAATTCAAACTCCAGAAACTCGTGCCCGAATTTTCC
 
. : . : . : . : . : . :
JMFN011N16+ CTTGTGACCCACGTAGTACCTCAGGTAAAACTCATCGCTCTCTTCCATTCTT
JMFN011I04+ CTTGTGACCCACGTAGTACCTCAGGTAAAACTCATCGCTCTCTTCCATTCTTGTCACCTC
rJMFF013H22- CTTGTGACCCACGTAGTACCTCAGGTAAAACTCATCGCTCTCTTCCATTCTTGTCACCTC
JMFN038H04+ CTTGTGACCCACGTAGTACCTCAGGTAAAACTCATCGCTCTCTTCCATTCTTGTCACCTC
rJMSF040O22- CTTGTGACCCACGTAGTACCTCAGGTAAAACTCATCGCTCTCTTCCATTCTTGTCACCTC
JMFF013H22+ CTTGTGACCCACGTAGTACCTCAGGTAAAACTCATCGCTCTCTTCCATTCTTGTCACCTC
                      ____________________________________________________________
consensus CTTGTGACCCACGTAGTACCTCAGGTAAAACTCATCGCTCTCTTCCATTCTTGTCACCTC
 
. : . : . : . : . : . :
JMFN011I04+ TTCGCACCTCTTTCTCACTC
rJMFF013H22- TTCGCACCTCTTTCTCACTCTTATCGCCGCCGG
JMFN038H04+ TTCGCACCTCTTTCTCACTCTTATCGCCGCCGGAGATTTTG
rJMSF040O22- TTCGCACCTCTTTCTCACTCTTATCGCCGCCGGAGATTTTGTGAGGACTATTCCTAGCA
JMFF013H22+ TTCGCACCTCTTTCTCACTCTTATCGCCGCCGGAGATTTTGTGAGGACTATTCCTAGCAG
                      ____________________________________________________________
consensus TTCGCACCTCTTTCTCACTCTTATCGCCGCCGGAGATTTTGTGAGGACTATTCCTAGCAG