Previous Contig 000708:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013G15Sequence554000708 (3)sp|P51850|DCP1_PEA8e-70Pyruvate decarboxylase isozyme 1 (EC 4.1.1.1) (PDC).>pir|S65470|S65470 pyruvate 724010570 (3)gb:AC121364_17401642e-65Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052E20, complet
JMFF045K22Sequence654000708 (3)gb:AJ717413_18137974e-86Lotus corniculatus var. japonicus mRNA for pyruvate decarboxylase isozyme 1 (pdc654010570 (3)gb:AC121364_17401642e-42Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052E20, complet
JMFS045D11Sequence608000708 (3)gb:AJ717413_18137978e-99Lotus corniculatus var. japonicus mRNA for pyruvate decarboxylase isozyme 1 (pdc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS045D11+ ACTTTGGAGCAAGGAAAAGTGAACATGGGTCTCTTGCAAAAGTAGGGTAGTGAATTCCT
                      ____________________________________________________________
consensus ACTTTGGAGCAAGGAAAAGTGAACATGGGTCTCTTGCAAAAGTAGGGTAGTGAATTCCT
 
. : . : . : . : . : . :
JMFS045D11+ GGCAAATTGCAGCTGATGCTAATGTAGACTGGCTTGCTTTCC-TTCAAAGCGGTTGAGAT
JMFF045K22+ ATTGCAGCTGATGCTAATGTAGACTGGC-TGCTNTCCTTTCAAAGCGGTGNAGAT
                      ____________________________________________________________
consensus GGCAAATTGCAGCTGATGCTAATGTAGACTGGCTTGCTTTCCTTTCAAAGCGGTTGAGAT
 
. : . : . : . : . : . :
JMFS045D11+ CGCAGTGTCTATCAACTCATGAGCGTCTTCCAAGTTATTCACCACCGCCTGAGAGCAAGT
JMFF045K22+ CGCAGTGTCTATCAACTCATGAGCGTCTTCCAAGTTATTCACCACCGCCTGAGAGCAAGT
JMFF013G15+ GCCTGAGAGCAAGT
                      ____________________________________________________________
consensus CGCAGTGTCTATCAACTCATGAGCGTCTTCCAAGTTATTCACCACCGCCTGAGAGCAAGT
 
. : . : . : . : . : . :
JMFS045D11+ GACCGTCTGAAAACAGCGGAGCTCCTGGGAGAAATCCGGCAGGCCGATGGTGTGGTGCAA
JMFF045K22+ GACCGTCTGAAAACAGCGGAGCTCCTGGGAGAAATCCGGCAGGCCGATGGTGTGGTGGAA
JMFF013G15+ GACCGTCTGAAAACAGCGGAGCTCCTGGGAGAAATCCGGCAGGCCGATGGTGTGGTGGAA
                      ____________________________________________________________
consensus GACCGTCTGAAAACAGCGGAGCTCCTGGGAGAAATCCGGCAGGCCGATGGTGTGGTGGAA
 
. : . : . : . : . : . :
JMFS045D11+ GATCCGGTTGGTGCCGTAGTCGTTGGAATTGGGGCCGCCGACGATGCAGATCACCGGCAG
JMFF045K22+ GATCCGGTTGGTGCCGTAGTCGTTGGAATTGGGGCCGCCGACGATGCAGATCACCGGCAG
JMFF013G15+ GATCCGGTTGGTGCCGTAGTCGTTGGAATTGGGGCCGCCGACGATGCAGATCACCGGCAG
                      ____________________________________________________________
consensus GATCCGGTTGGTGCCGTAGTCGTTGGAATTGGGGCCGCCGACGATGCAGATCACCGGCAG
 
. : . : . : . : . : . :
JMFS045D11+ ATTCTCACTGTAGGCGCCGGCGATGGCGTTGAGCACGCTCAGCCCGCCCACCGTGAAGGT
JMFF045K22+ ATTCTCACTGTAGGCGCCGGCGATGGCGTTGAGCACGCTCAGCCCGCCCACCGTGAAGGT
JMFF013G15+ ATTCTCACTGTAGGCGCCGGCGATGGCGTTGAGCACGCTCAGCCCGCCCACCGTGAAGGT
                      ____________________________________________________________
consensus ATTCTCACTGTAGGCGCCGGCGATGGCGTTGAGCACGCTCAGCCCGCCCACCGTGAAGGT
 
. : . : . : . : . : . :
JMFS045D11+ GACCACACAGGCGCCCACCCCGTTGGCGCGAGCGTAGCCGTCCGCGGCGTAGCCGGCGTT
JMFF045K22+ GACCACACAGGCGCCCACCCCGTTGGCGCGAGCGTAGCCGTCCGCGGCGTAGCCGGCGTT
JMFF013G15+ GACCACACAGGCGCCCACCCCGTTGGCGCGAGCGTAGCCGTCCGCGGCGTAGCCGGCGTT
                      ____________________________________________________________
consensus GACCACACAGGCGCCCACCCCGTTGGCGCGAGCGTAGCCGTCCGCGGCGTAGCCGGCGTT
 
. : . : . : . : . : . :
JMFS045D11+ GAGCTCGTTACAGCAGCCGATCAGGTTCAGCTCCGGCTCGGCGATCAGGTGATCCAGCAG
JMFF045K22+ GAGCTCGTTACAGCAGCCGATCAGGTTCAGCTCCGGCTCGGCGATCAGGTGATCCAGCAG
JMFF013G15+ GAGCTCGTTACAGCAGCCGATCAGGTTCAGCTCCGGCTCGGCGATCAGGTGATCCAGCAG
                      ____________________________________________________________
consensus GAGCTCGTTACAGCAGCCGATCAGGTTCAGCTCCGGCTCGGCGATCAGGTGATCCAGCAG
 
. : . : . : . : . : . :
JMFS045D11+ CGTCAAGTTGAAGTCCCCGGGGACGGAGAACACATCCCTCACGCCAATCTGGACCAGCCG
JMFF045K22+ CGTCAAGTTGAAGTCCCCGGGGACGGAGAACACATCCCTCACGCCAATCTGGACCAGCCG
JMFF013G15+ CGTCAAGTTGAAGTCCCCGGGGACGGAGAACACATCCCTCACGCCAATCTGGACCAGCCG
                      ____________________________________________________________
consensus CGTCAAGTTGAAGTCCCCGGGGACGGAGAACACATCCCTCACGCCAATCTGGACCAGCCG
 
. : . : . : . : . : . :
JMFS045D11+ CTTAGCCAAGTGCCTCCCCAGCGTTCCGTTCGCGCAGCTCTGCTGGATTATTGAACCGTT
JMFF045K22+ CTTAGCCAAGTGCCTCCCCAGCGTTCCGTTCGCGCAGCTCTGCTGGATTATTGAACCGTT
JMFF013G15+ CTTAGCCAAGTGCCTCCCCAGCGTTCCGTTCGCGCAGCTCTGCTGGATTATTGAACCGTT
                      ____________________________________________________________
consensus CTTAGCCAAGTGCCTCCCCAGCGTTCCGTTCGCGCAGCTCTGCTGGATTATTGAACCGTT
 
. : . : . : . : . : . :
JMFS045D11+ TGATTTTTCC
JMFF045K22+ TGATTTTTCCATATCTTAATTCCAATCAACAGAATTAATGAGTTTGATTATGCTTCCAAA
JMFF013G15+ TGATTTTTCCATATCTTAATTCCAATCAACAGAATTAATGAGTTTGATTATGCTTCCAAA
                      ____________________________________________________________
consensus TGATTTTTCCATATCTTAATTCCAATCAACAGAATTAATGAGTTTGATTATGCTTCCAAA
 
. : . : . : . : . : . :
JMFF045K22+ TCGGGGGGTTCTGCTCTTTTTATACTGTACTGGTTCCAGGTTTTGAAGACTGTGGGCAGA
JMFF013G15+ TCGGGGGGTTCTGCTCTTTTTATACTGTACTGGTTCCAGGTTTTGAAGACTGTGGGCAGA
                      ____________________________________________________________
consensus TCGGGGGGTTCTGCTCTTTTTATACTGTACTGGTTCCAGGTTTTGAAGACTGTGGGCAGA