Previous Contig 000702:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013F06Sequence506000702 (5)gb:AF059487_17650424e-50Lycopersicon esculentum expansin precursor (EXPA3) mRNA, complete cds.
JMSF006E22Sequence352000702 (5)gb:AF059487_17650423e-25Lycopersicon esculentum expansin precursor (EXPA3) mRNA, complete cds.211000702 (5)
JMSF034L24Sequence697000702 (5)gb:AF059487_17650427e-95Lycopersicon esculentum expansin precursor (EXPA3) mRNA, complete cds.713000702 (5)gb:AF059487_17650423e-51Lycopersicon esculentum expansin precursor (EXPA3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034L24- TTCTGGCTCCGATTCATTGACAGAAGTTAAATCTGGTATTC
                      ____________________________________________________________
consensus TTCTGGCTCCGATTCATTGACAGAAGTTAAATCTGGTATTC
 
. : . : . : . : . : . :
rJMSF034L24- CTTTAAACTGACCACCAGGGTTATAGATTACAATTTAATGACTGGAATCAGACTACACAT
                      ____________________________________________________________
consensus CTTTAAACTGACCACCAGGGTTATAGATTACAATTTAATGACTGGAATCAGACTACACAT
 
. : . : . : . : . : . :
rJMSF034L24- TTGGCAAGATGTGTGGTCTGATTTTGATATGGAAACCAGAAATTTTGAGATGCCTTATCC
                      ____________________________________________________________
consensus TTGGCAAGATGTGTGGTCTGATTTTGATATGGAAACCAGAAATTTTGAGATGCCTTATCC
 
. : . : . : . : . : . :
rJMSF006E22- ATTTCTAATTACATTNGCCNCA
rJMSF034L24- AAAAGAACTGCAGCTATCATCACTAAGTGCAGTTTGGGATTTCTAATTACATTTGCCACA
                      ____________________________________________________________
consensus AAAAGAACTGCAGCTATCATCACTAAGTGCAGTTTGGGATTTCTAATTACATTTGCCACA
 
. : . : . : . : . : . :
rJMSF006E22- CAAAAACANCCACAAGANCNATGNCTTATNTCTAGCTTATAGCCTTATACCATGGCTCNA
rJMSF034L24- CAAAAACAACCACAAGAACAATGGCTTATATCTAGCTTATAGCCTTATACCATGGC-AAA
                      ____________________________________________________________
consensus CAAAAACAACCACAAGAACAATGGCTTATATCTAGCTTATAGCCTTATACCATGGCTCAA
 
. : . : . : . : . : . :
rJMSF006E22- GCTCAAAGGTTCTATAATGGTGGCAACCCTTTCCAGTATGANTGTCCANGCAANGAAATT
rJMSF034L24- GCTCAAAGGTTCTATAATGGTGGCAACCCTTTCCAGTATGAATGTCCAGGCAATGAAATT
                      ____________________________________________________________
consensus GCTCAAAGGTTCTATAATGGTGGCAACCCTTTCCAGTATGAATGTCCAGGCAATGAAATT
 
. : . : . : . : . : . :
rJMSF006E22- CATGGAGATTTTACTTAAAGCTTCAAAGTTCAAACTGCTTACCTTCNAAAGTCTGTCCNA
rJMSF034L24- CATGGAGATTTTACTTAAAGCTTCAAAGTTCAAACTGCTTACCTTCAAAAGTCTGTCCAA
                      ____________________________________________________________
consensus CATGGAGATTTTACTTAAAGCTTCAAAGTTCAAACTGCTTACCTTCAAAAGTCTGTCCAA
 
. : . : . : . : . : . :
rJMSF006E22- AATCCCAGT
rJMSF034L24- AATCCCAGTTCTTGGGAGCAACACTGTAAGAAGTGAGGGTGACTTTATCGCTGGTAGCTA
                      ____________________________________________________________
consensus AATCCCAGTTCTTGGGAGCAACACTGTAAGAAGTGAGGGTGACTTTATCGCTGGTAGCTA
 
. : . : . : . : . : . :
rJMSF034L24- TCTCGAACGAAAGAGGTTGGTTCTTCAAGTCAGCATTTATGTGCCAGATTTGGCCCCAAT
                      ____________________________________________________________
consensus TCTCGAACGAAAGAGGTTGGTTCTTCAAGTCAGCATTTATGTGCCAGATTTGGCCCCAAT
 
. : . : . : . : . : . :
rJMSF034L24- TCCTGCCCATTGGAAGCCATCCTGTTCTCGTGCCCTTAATTTTCACCGCAACGATGTCAC
JMSF034L24+ TTTCACCGCAACGATGTCAC
                      ____________________________________________________________
consensus TCCTGCCCATTGGAAGCCATCCTGTTCTCGTGCCCTTAATTTTCACCGCAACGATGTCAC
 
. : . : . : . : . : . :
rJMSF034L24- CAGCACCCGCAACGTTGCTGATCAGCACCGACAGGGAGATTCCTGCACCGGTTAAGGTGA
JMSF034L24+ CAGCACCCGCAACGTTGCTGATCAGCACCGACAGGGAGATTCCTGCACCGGTTAAGGTGA
                      ____________________________________________________________
consensus CAGCACCCGCAACGTTGCTGATCAGCACCGACAGGGAGATTCCTGCACCGGTTAAGGTGA
 
. : . : . : . : . : . :
rJMSF034L24- ATCGCACTCCTCCTTCCTTTCTGCACTTTATTCTGCGGTACTGAATGGGCATATTCGAAG
JMSF034L24+ ATCGCACTCCTCCTTCCTTTCTGCACTTTATTCTGCGGTACTGAATGGGCATATTCGAAG
                      ____________________________________________________________
consensus ATCGCACTCCTCCTTCCTTTCTGCACTTTATTCTGCGGTACTGAATGGGCATATTCGAAG
 
. : . : . : . : . : . :
rJMSF034L24- CTTTCCNAAGGGC
JMSF034L24+ CTTTCCAAAGGGCAATCTTTTCAAAAGCCTCGATAGGCAGCACGAAATGAGCGTTGGGGG
                      ____________________________________________________________
consensus CTTTCCAAAGGGCAATCTTTTCAAAAGCCTCGATAGGCAGCACGAAATGAGCGTTGGGGG
 
. : . : . : . : . : . :
JMSF034L24+ GATTGCAATGGCCGCCGCCGTCGGGGTCGAAGCCGTAGTTGGGAGCGCAAAAATTGGTAG
JMFF013F06+ GTAGTTGGGAGCGCAAAAATTGGTAG
                      ____________________________________________________________
consensus GATTGCAATGGCCGCCGCCGTCGGGGTCGAAGCCGTAGTTGGGAGCGCAAAAATTGGTAG
 
. : . : . : . : . : . :
JMSF034L24+ CGGTGACAATAATGGAAGTTCCGGGGATACACCACCGGAGATCCTCCACGCACCTGACCT
JMFF013F06+ CGGTGACAATAATGGAAGTTCCGGGGATACACCACCGGAGATCCTCCACGCACCTGACCT
                      ____________________________________________________________
consensus CGGTGACAATAATGGAAGTTCCGGGGATACACCACCGGAGATCCTCCACGCACCTGACCT
 
. : . : . : . : . : . :
JMSF034L24+ CAAAGCACGCGCCGCAGATCTGACCCCTCTCGAACAGCACCGTGCTCAGCCCAGCCGTCG
JMSF006E22+ CCTCCCGAACAGCACCGTGCTCAGCCCAGCCGTCG
JMFF013F06+ CAAAGCACGCGCCGCAGATCTGACCCCTCTCGAACAGCACCGTGCTCAGCCCAGCCGTCG
                      ____________________________________________________________
consensus CAAAGCACGCGCCGCAGATCTGACCCCTCTCGAACAGCACCGTGCTCAGCCCAGCCGTCG
 
. : . : . : . : . : . :
JMSF034L24+ CCTTGCCGTAGCCGCTCCTCTCCAAATCCCCGAACCCGCACGCGCCGCCCACCGCATCCC
JMSF006E22+ CCTTGCCGTAGCCGCTCCTCTCCAAATCCCCGAACCCGCACGCGCCGCCCACCGCATCCC
JMFF013F06+ CCTTGCCGTAGCCGCTCCTCTCCAAATCCCCGAACCCGCACGCGCCGCCCACCGCATCCC
                      ____________________________________________________________
consensus CCTTGCCGTAGCCGCTCCTCTCCAAATCCCCGAACCCGCACGCGCCGCCCACCGCATCCC
 
. : . : . : . : . : . :
JMSF034L24+ GGGGATCCGCCGGCGCGTAGTAGGTCGCCCGCGCTGGCCGCCACTCGGATTGCACGGGCG
JMSF006E22+ GGGGATCCGCCGGCGCGTAGTAGGTCGCCCGCGCTGGCCGCCACTCGGATTGCACGGGCG
JMFF013F06+ GGGGATCCGCCGGCGCGTAGTAGGTCGCCCGCGCTGGCCGCCACTCGGATTGCACGGGCG
                      ____________________________________________________________
consensus GGGGATCCGCCGGCGCGTAGTAGGTCGCCCGCGCTGGCCGCCACTCGGATTGCACGGGCG
 
. : . : . : . : . : . :
JMSF034L24+ CGGAGGAGGATGGCCAGTGGTAGTGTGAATGAACCGACGGCGTTATCGAACAGAGTATCA
JMSF006E22+ CGGAGGAGGATGGCCAGTGGTAGTGTGAATGAACCGACGGCGTTATCGAACAGAGTATCA
JMFF013F06+ CGGAGGAGGATGGCCAGTGGTAGTGTGAATGAACCGACGGCGTTATCGAACAGAGTATCA
                      ____________________________________________________________
consensus CGGAGGAGGATGGCCAGTGGTAGTGTGAATGAACCGACGGCGTTATCGAACAGAGTATCA
 
. : . : . : . : . : . :
JMSF034L24+ CGGCGGCTAGAACACGTAGTACAGTTGCCGGCATGGTATTGTAGCTCTTATGGCTTCTGC
JMSF006E22+ CGGCGGCTAGAACACGTAGTACAGTTGCCGGCATGGTATTGTAGCTCTTATGGCTTCTGC
JMFF013F06+ CGGCGGCTAGAACACGTAGTACAGTTGCCGGCATGGTATTGTAGCTCTTATGGCTTCTGC
                      ____________________________________________________________
consensus CGGCGGCTAGAACACGTAGTACAGTTGCCGGCATGGTATTGTAGCTCTTATGGCTTCTGC
 
. : . : . : . : . : . :
JMSF034L24+ CGGAGTCGGCGCCGACGCTGTGACAGCGGAAAATGCAAGCAAGGTGGTGTGCTTGTATAG
JMSF006E22+ CGGAGTCGGCGCCGACGCTGTGACAGCGGAAAATGCAAGCAAGGTGGTGTGCTTGTATAG
JMFF013F06+ CGGAGTCGGCGCCGACGCTGTGACAGCGGAAAATGCAAGCAAGGTGGTGTGCTTGTATAG
                      ____________________________________________________________
consensus CGGAGTCGGCGCCGACGCTGTGACAGCGGAAAATGCAAGCAAGGTGGTGTGCTTGTATAG
 
. : . : . : . : . : . :
JMSF034L24+ ATTTTTTTAATTTT
JMSF006E22+ ATTTTTTTAATTTT
JMFF013F06+ ATTTTTTTAATTTTCCGGTTTCGAAATCGGCGGTGTGGGGTATTTACTTCCACTGTTGGT
                      ____________________________________________________________
consensus ATTTTTTTAATTTTCCGGTTTCGAAATCGGCGGTGTGGGGTATTTACTTCCACTGTTGGT