Previous Contig 000697:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001D14Sequence318000697 (5)
JMFF013D08Sequence599000697 (5)gb:AF532620_18094221e-15Glycine max hypothetical protein mRNA, complete cds.715000697 (5)gb:AF532620_18094223e-42Glycine max hypothetical protein mRNA, complete cds.
JMFF025N02Sequence570000697 (5)gb:AF532620_18094229e-40Glycine max hypothetical protein mRNA, complete cds.689000697 (5)gb:AF532620_18094226e-41Glycine max hypothetical protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013D08- AATAACTTATTCTTTGAAACAAGTCAGCAACGTACACAGATAGAACCACCGAATTTGTG
                      ____________________________________________________________
consensus AATAACTTATTCTTTGAAACAAGTCAGCAACGTACACAGATAGAACCACCGAATTTGTG
 
. : . : . : . : . : . :
rJMFF013D08- TTTTTGTAGTAGTCTATACTATAAAAGATCATTCCAGTACCAGAATCTGTGTCTGTCTGA
                      ____________________________________________________________
consensus TTTTTGTAGTAGTCTATACTATAAAAGATCATTCCAGTACCAGAATCTGTGTCTGTCTGA
 
. : . : . : . : . : . :
rJMFF013D08- ATTTGTCAGAAGGCAAAATGCACTTTTACTTTAAATTACCTATCTGCCATAAATAAACCA
rJMFF025N02- ATTACCTATCTGCCATAAATAAACCA
                      ____________________________________________________________
consensus ATTTGTCAGAAGGCAAAATGCACTTTTACTTTAAATTACCTATCTGCCATAAATAAACCA
 
. : . : . : . : . : . :
rJMFF013D08- AACTAAAAGTACATTCATCAATTCTGTCCAACTAACTAATGTTACACCAGGTTCAGTCAT
rJMFF025N02- AACTAAAAGTACATTCATCAATTCTGTCCAACTAACTAATGTTACACCAGGTTCAGTCAT
                      ____________________________________________________________
consensus AACTAAAAGTACATTCATCAATTCTGTCCAACTAACTAATGTTACACCAGGTTCAGTCAT
 
. : . : . : . : . : . :
rJMFF013D08- CATACATCCCAACCATCCTGCTCCCAAACATCCACAAGAAAATCTATCATTTCAGGAAGG
JMFF025N02+ CTGCTCCCAAACATCCACAAGAAAATCTATCATTTCAGGAAGG
rJMFF025N02- CATACATCCCAACCATCCTGCTCCCAAACATCCACAAGAAAATCTATCATTTCAGGAAGG
                      ____________________________________________________________
consensus CATACATCCCAACCATCCTGCTCCCAAACATCCACAAGAAAATCTATCATTTCAGGAAGG
 
. : . : . : . : . : . :
rJMFF013D08- GGTATAGGCTTAGCGAATTGTTTGTTGCTACCAAGTAAACTATCATATGTAGCATTCCAA
JMFF025N02+ GGTATAGGCTTAGCGAATTGTTTGTTGCTACCAAGTAAACTATCATATGTAGCATTCCAA
rJMFF025N02- GGTATAGGCTTAGCGAATTGTTTGTTGCTACCAAGTAAACTATCATATGTAGCATTCCAA
                      ____________________________________________________________
consensus GGTATAGGCTTAGCGAATTGTTTGTTGCTACCAAGTAAACTATCATATGTAGCATTCCAA
 
. : . : . : . : . : . :
rJMFF013D08- CTTAATCTGGGCTCAAGCAGCTGCTGTGACTGATTTTCAGACTTTTTACTTCCCACCCAC
JMFF025N02+ CTTAATCTGGGCTCAAGCAGCTGCTGTGACTGATTTTCAGACTTTTTACTTCCCACCCAC
rJMFF025N02- CTTAATCTGGGCTCAAGCAGCTGCTGTGACTGATTTTCAGACTTTTTACTTCCCACCCAC
JMFF013D08+ CCAC
                      ____________________________________________________________
consensus CTTAATCTGGGCTCAAGCAGCTGCTGTGACTGATTTTCAGACTTTTTACTTCCCACCCAC
 
. : . : . : . : . : . :
rJMFF013D08- TGCTGTCGAATTTGGGTCCATTGAATAAGTCCATGATTTACAAATTCAGAAGGGGTGTTT
JMFF025N02+ TGCTGTCGAATTTGGGTCCATTGAATAAGTCCATGATTTACAAATTCAGAAGGGGTGTTT
rJMFF025N02- TGCTGTCGAATTTGGGTCCATTGAATAAGTCCATGATTTACAAATTCAGAAGGGGTGTTT
JMFF013D08+ TGCTGTCGAATTTGGGTCCATTGAATAAGTCCATGATTTACAAATTCAGAAGGGGTGTTT
                      ____________________________________________________________
consensus TGCTGTCGAATTTGGGTCCATTGAATAAGTCCATGATTTACAAATTCAGAAGGGGTGTTT
 
. : . : . : . : . : . :
rJMFF013D08- GTACTTCCACTGCTGTGGGCATCATGTGCCTGGGCTGACGTACTAATTGATGATATGCTT
JMFF025N02+ GTACTTCCACTGCTGTGGGCATCATGTGCCTGGGCTGACGTACTAATTGATGATATGCTT
rJMFF025N02- GTACTTCCACTGCTGTGGGCATCATGTGCCTGGGCTGACGTACTAATTGATGATATGCTT
JMFF013D08+ GTACTTCCACTGCTGTGGGCATCATGTGCCTGGGCTGACGTACTAATTGATGATATGCTT
                      ____________________________________________________________
consensus GTACTTCCACTGCTGTGGGCATCATGTGCCTGGGCTGACGTACTAATTGATGATATGCTT
 
. : . : . : . : . : . :
rJMFF013D08- CCTCGAGACTGAACAACATTGTTATCCATGTCCCGTGTGCTAGTAGTCCAGAAATCTTCT
JMFF025N02+ CCTCGAGACTGAACAACATTGTTATCCATGTCCCGTGTGCTAGTAGTCCAGAAATCTTCT
rJMFF025N02- CCTCGAGACTGAACAACATTGTTATCCATGTCCCGTGTGCTAGTAGTCCAGAAATCTTCT
JMFF013D08+ CCTCGAGACTGAACAACATTGTTATCCATGTCCCGTGTGCTAGTAGTCCAGAAATCTTCT
                      ____________________________________________________________
consensus CCTCGAGACTGAACAACATTGTTATCCATGTCCCGTGTGCTAGTAGTCCAGAAATCTTCT
 
. : . : . : . : . : . :
rJMFF013D08- GATGTGCTACGTACTGGAGCCTTGCTATCCTTTATTTTCTGCCTTCTTGCTGACTTGTTC
JMFF025N02+ GATGTGCTACGTACTGGAGCCTTGCTATCCTTTATTTTCTGCCTTCTTGCTGACTTGTTC
rJMFF025N02- GATGTGCTACGTACTGGAGCCTTGCTATCCTTTATTTTCTGCCTTCTTGCTGACTTGTTC
JMFF001D14+ TACGTACTGGAGCCTTGCTATCCTNTATTTTCTGCCTTCTTGCTGACTTGTTC
JMFF013D08+ GATGTGCTACGTACTGGAGCCTTGCTATCCTTTATTTTCTGCCTTCTTGCTGACTTGTTC
                      ____________________________________________________________
consensus GATGTGCTACGTACTGGAGCCTTGCTATCCTTTATTTTCTGCCTTCTTGCTGACTTGTTC
 
. : . : . : . : . : . :
rJMFF013D08- AAGGATAAAGTCAATTTTGCCTTATTATCGCATCCAAGACAACCAC
JMFF025N02+ AAGGATAAAGTCAATTTTGCCTTATTATCGCATCCAAGACAACCAC
rJMFF025N02- AAGGATAAAGTCAATTTTGCCTTATTATCGCATCCAAGACAACCAC
JMFF001D14+ AAGGATAAAGTCAATTNTNCCTTATTATCGCATCCAAGACAACCACTGCTCCCATGGCGG
JMFF013D08+ AAGGATAAAGTCAATTTTGCCTTATTATCGCATCCAAGACAACCAC-----CCATGGCGG
                      ____________________________________________________________
consensus AAGGATAAAGTCAATTTTGCCTTATTATCGCATCCAAGACAACCACTGCTCCCATGGCGG
 
. : . : . : . : . : . :
JMFF001D14+ CGAGGATTTGGAGAAGCCCCAACCGCAAGAGATCCAACAGAGAGTAACGTTGCCACAATA
JMFF013D08+ CGAGGATTTGGAGAAGCCCCAACCGCAAGAGATCCAACAGAGAGTAACGTTGCCACAATA
                      ____________________________________________________________
consensus CGAGGATTTGGAGAAGCCCCAACCGCAAGAGATCCAACAGAGAGTAACGTTGCCACAATA
 
. : . : . : . : . : . :
JMFF001D14+ AACNCCGATTCCAGGAAGATCTCACACGTCTTTCACAAATGCCTGAGAGAGAAAGGTGTG
JMFF013D08+ AACGCCGATTCCAGGAAGATCTCACACGTCTTTCACAAATGCCTGAGAGAGAAAGGTGTG
                      ____________________________________________________________
consensus AACGCCGATTCCAGGAAGATCTCACACGTCTTTCACAAATGCCTGAGAGAGAAAGGTGTG
 
. : . : . : . : . : . :
JMFF001D14+ GCGATCTTTCTCCCTCTGTGTCAGTGCGAGGCCCTTCCCGAAATCGATCGCGTTCTGCAA
JMFF013D08+ GCGATCTTTCTCCCTCTGTGTCAGTGCGAGGCCCTTCCCGAAATCGATCGCGTTCTGCAA
                      ____________________________________________________________
consensus GCGATCTTTCTCCCTCTGTGTCAGTGCGAGGCCCTTCCCGAAATCGATCGCGTTCTGCAA
 
. : . : . : . : . : . :
JMFF001D14+ GAGGATTAAAGTAATAGGTTC
JMFF013D08+ GAGGATTAAAGTAATAGGTTCATACGGCTTTTCTGGTTCTCTCAGTGGTTACTAAAAGGA
                      ____________________________________________________________
consensus GAGGATTAAAGTAATAGGTTCATACGGCTTTTCTGGTTCTCTCAGTGGTTACTAAAAGGA
 
. : . : . : . : . : . :
JMFF013D08+ AGAGGAAGAAGAAGAAGAGGCAGCTCAAAAACATTGGCATCGCGTATCTCCCGAAAAGGG
                      ____________________________________________________________
consensus AGAGGAAGAAGAAGAAGAGGCAGCTCAAAAACATTGGCATCGCGTATCTCCCGAAAAGGG