Previous Contig 000685:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012P12Sequence417000685 (2)796003214 (4)pir|T02594|T025946e-38hypothetical protein At2g14820 [imported] - Arabidopsis thaliana>gb:AC004705_153
JMFF037H16Sequence505000685 (2)800003214 (4)pir|T02594|T025942e-38hypothetical protein At2g14820 [imported] - Arabidopsis thaliana>gb:AC004705_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF037H16+ CCCAGTCAGCCAAGGAGACACAACC
                      ____________________________________________________________
consensus CCCAGTCAGCCAAGGAGACACAACC
 
. : . : . : . : . : . :
JMFF037H16+ AACAGACTTTGAACACTAAATTATTCCCAAAACCAGAGAAACACCCACTAGCATCACCTT
                      ____________________________________________________________
consensus AACAGACTTTGAACACTAAATTATTCCCAAAACCAGAGAAACACCCACTAGCATCACCTT
 
. : . : . : . : . : . :
JMFF037H16+ TCCCTTCTTATTTTCTATATTTCCCCCATTATCTTTACCAGCATAAACAATACTAAATTG
JMFF012P12+ CTTCTTATTTTCTATATTTCCCCCATTATCTTTACCAGCATAAACAATACTAAATTG
                      ____________________________________________________________
consensus TCCCTTCTTATTTTCTATATTTCCCCCATTATCTTTACCAGCATAAACAATACTAAATTG
 
. : . : . : . : . : . :
JMFF037H16+ CTCTACAAAACTGAAATGCTCAAACTTCAATCACATGTAATAATAAATCCATAATATTTT
JMFF012P12+ CTCTACAAAACTGAAATGCTCAAACTTCAATCACATGTAATAATAAATCCATAATATTTT
                      ____________________________________________________________
consensus CTCTACAAAACTGAAATGCTCAAACTTCAATCACATGTAATAATAAATCCATAATATTTT
 
. : . : . : . : . : . :
JMFF037H16+ AAAGATACGGTTGCATACCTGCAACACAGAACAGCATCTTAGAGTCAGATGAAGAACCCC
JMFF012P12+ AAAGATACGGTTGCATACCTGCAACACAGAACAGCATCTTAGAGTCAGATGAAGAACCCC
                      ____________________________________________________________
consensus AAAGATACGGTTGCATACCTGCAACACAGAACAGCATCTTAGAGTCAGATGAAGAACCCC
 
. : . : . : . : . : . :
JMFF037H16+ TCACAGCGGTGGACAGCAAGCATCTTTCATAGTTTTTGCAAAGCAGGCATCAGCTACCAG
JMFF012P12+ TCACAGCGGTGGACAGCAAGCATCTTTCATAGTTTTTGCAAAGCAGGCATCAGCTACCAG
                      ____________________________________________________________
consensus TCACAGCGGTGGACAGCAAGCATCTTTCATAGTTTTTGCAAAGCAGGCATCAGCTACCAG
 
. : . : . : . : . : . :
JMFF037H16+ CAAGATCTTAGGGAGTTCAAAGAATCATTTCAGCGAACACATAACGGGCAATTAAAATAT
JMFF012P12+ CAAGATCTTAGGGAGTTCAAAGAATCATTTCAGCGAACACATAACGGGCAATTAAAATAT
                      ____________________________________________________________
consensus CAAGATCTTAGGGAGTTCAAAGAATCATTTCAGCGAACACATAACGGGCAATTAAAATAT
 
. : . : . : . : . : . :
JMFF037H16+ TAAGCCATGATCTTCATGAAGTTTTGGCAAGAATGAAAGCATCACCCTTGTAAACAGAAC
JMFF012P12+ TAAGCCATGATCTTCATGAAGTTTTGGCAAGAATGAAAGCATCACCCTTGTAAACAGAAC
                      ____________________________________________________________
consensus TAAGCCATGATCTTCATGAAGTTTTGGCAAGAATGAAAGCATCACCCTTGTAAACAGAAC
 
. : . : . : . : . : . :
JMFF037H16+ CCCAAAACCCAATACTTTTTAGCATTTAGAAACACAAGAAATTCTTTTTCAAAGAGACTT
JMFF012P12+ CCCAAAACCCAATACTTTTTAGCATTTAGAAACACAAGAAATTCTTTTTCAAAGAGACTT
                      ____________________________________________________________
consensus CCCAAAACCCAATACTTTTTAGCATTTAGAAACACAAGAAATTCTTTTTCAAAGAGACTT