Previous Contig 000683:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012P04Sequence560000683 (6)gb:BT004058_16371671e-21Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina724013329 (3)gb:BT004058_16371676e-31Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMFF036L20Sequence585000683 (6)gb:BT004058_16371678e-26Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina622013329 (3)gb:BT004058_16371677e-15Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMFS017D11Sequence599000683 (6)gb:BT004058_16371676e-30Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMFS023G12Sequence561000683 (6)gb:BT004058_16371675e-30Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMFS160D06Sequence581000683 (6)gb:BT004058_16371678e-28Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMSF041C03Sequence274000683 (6)536013329 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS160D06+ GAAGGAATGGG
JMFS023G12+ CCGGTCAATGTCGGAAGGAATGGG
JMFS017D11+ CCGGTCAATGTCGGAAGGAATGGG
                      ____________________________________________________________
consensus CCGGTCAATGTCGGAAGGAATGGG
 
. : . : . : . : . : . :
JMFS160D06+ GCCCACGAAGAAGTTCTGAGAGAGGTCCAAGTACTCCAGCTTCGAGCAGTTATACAAACC
JMFS023G12+ GCCCACGAAGAAGTTCTGAGAGAGGTCCAAGTACTCCAGCTTCGAGCAGTTATACAAACC
JMFS017D11+ GCCCACGAAGAAGTTCTGAGAGAGGTCCAAGTACTCCAGCTTCGAGCAGTTATACAAACC
JMFF036L20+ TCTGAGAGAGGTCCAAGTACTCCAGCTTCGAGCAGTTATACAAACC
JMFF012P04+ CTTCGAGCAGTTATACAAACC
                      ____________________________________________________________
consensus GCCCACGAAGAAGTTCTGAGAGAGGTCCAAGTACTCCAGCTTCGAGCAGTTATACAAACC
 
. : . : . : . : . : . :
JMFS160D06+ CGTCGGAAAATTGTTCGGAATATAATTCAAGGAAAGATCGAGGGCGGTGAGATTTTTAAG
JMFS023G12+ CGTCGGAAAATTGTTCGGAATATAATTCAAGGAAAGATCGAGGGCGGTGAGATTTTTAAG
JMFS017D11+ CGTCGGAAAATTGTTCGGAATATAATTCAAGGAAAGATCGAGGGCGGTGAGATTTTTAAG
JMFF036L20+ CGTCGGAAAATTGTTCGGAATATAATTCAAGGAAAGATCGAGGGCGGTGAGATTTTTAAG
JMFF012P04+ CGTCGGAAAATTGTTCGGAATATAATTCAAGGAAAGATCGAGGGCGGTGAGATTTTTAAG
                      ____________________________________________________________
consensus CGTCGGAAAATTGTTCGGAATATAATTCAAGGAAAGATCGAGGGCGGTGAGATTTTTAAG
 
. : . : . : . : . : . :
JMFS160D06+ GCCGCAAATATTGGCCGGAATTTCCGACACGATGTCATACTCCTTTAAAAAGATTCCGGT
JMFS023G12+ GCCGCAAATATTGGCCGGAATTTCCGACACGATGTCATACTCCTTTAAAAAGATTCCGGT
JMFS017D11+ GCCGCAAATATTGGCCGGAATTTCCGACACGATGTCATACTCCTTTAAAAAGATTCCGGT
JMFF036L20+ GCCGCAAATATTGGCCGGAATTTCCGACACGATGTCATACTCCTTTAAAAAGATTCCGGT
JMFF012P04+ GCCGCAAATATTGGCCGGAATTTCCGACACGATGTCATACTCCTTTAAAAAGATTCCGGT
                      ____________________________________________________________
consensus GCCGCAAATATTGGCCGGAATTTCCGACACGATGTCATACTCCTTTAAAAAGATTCCGGT
 
. : . : . : . : . : . :
JMFS160D06+ GACGGAGCCGCCGGAGCACTCAATCTCCGGCCAGCTACACGGCGAGGAGGTGGCGTTCCA
JMFS023G12+ GACGGAGCCGCCGGAGCACTCAATCTCCGGCCAGCTACACGGCGAGGAGGTGGCGTTCCA
JMFS017D11+ GACGGAGCCGCCGGAGCACTCAATCTCCGGCCAGCTACACGGCGAGGAGGTGGCGTTCCA
JMFF036L20+ GACGGAGCCGCCGGAGCACTCAATCTCCGGCCAGCTACACGGCGAGGAGGTGGCGTTCCA
JMFF012P04+ GACGGAGCCGCCGGAGCACTCAATCTCCGGCCAGCTACACGGCGAGGAGGTGGCGTTCCA
                      ____________________________________________________________
consensus GACGGAGCCGCCGGAGCACTCAATCTCCGGCCAGCTACACGGCGAGGAGGTGGCGTTCCA
 
. : . : . : . : . : . :
JMFS160D06+ TCCTTCAAGAGACGGCGGATTACCCCACCGCCGTTTCACCTCCAATAAGATATCACGGTC
JMFS023G12+ TCCTTCAAGAGACGGCGGATTACCCCACCGCCGTTTCACCTCCAATAAGATATCACGGTC
JMFS017D11+ TCCTTCAAGAGACGGCGGATTACCCCACCGCCGTTTCACCTCCAATAAGATATCACGGTC
JMFF036L20+ TCCTTCAAGAGACGGCGGATTACCCCACCGCCGTTTCACCTCCAATAAGATATCACGGTC
JMFF012P04+ TCCTTCAAGAGACGGCGGATTACCCCACCGCCGTTTCACCTCCAATAAGATATCACGGTC
                      ____________________________________________________________
consensus TCCTTCAAGAGACGGCGGATTACCCCACCGCCGTTTCACCTCCAATAAGATATCACGGTC
 
. : . : . : . : . : . :
JMFS160D06+ GGTCACCGGAGATTGCGAAATCACCGCAAAGGGCATTAAGGAAAAGAGAAACAGGAAAAG
JMFS023G12+ GGTCACCGGAGATTGCGAAATCACCGCAAAGGGCATTAAGGAAAAGAGAAACAGGAAAAG
JMFS017D11+ GGTCACCGGAGATTGCGAAATCACCGCAAAGGGCATTAAGGAAAAGAGAAACAGGAAAAG
JMFF036L20+ GGTCACCGGAGATTGCGAAATCACCGCAAAGGGCATTAAGGAAAAGAGAAACAGGAAAAG
JMSF041C03+ CAAAGGGCATTAAGGAAAAGAGAAACAGGAAAAG
JMFF012P04+ GGTCACCGGAGATTGCGAAATCACCGCAAAGGGCATTAAGGAAAAGAGAAACAGGAAAAG
                      ____________________________________________________________
consensus GGTCACCGGAGATTGCGAAATCACCGCAAAGGGCATTAAGGAAAAGAGAAACAGGAAAAG
 
. : . : . : . : . : . :
JMFS160D06+ ATAAGACGGAAATATGGAAAAGCACCGGAGTAAATTCGTCATTTTCCTAGTCAAACGGCG
JMFS023G12+ ATAAGACGGAAATATGGAAAAGCACCGGAGTAAATTCGTCATTTTCCTAGTCAAACGGCG
JMFS017D11+ ATAAGACGGAAATATGGAAAAGCACCGGAGTAAATTCGTCATTTTCCTAGTCAAACGGCG
JMFF036L20+ ATAAGACGGAAATATGGAAAAGCACCGGAGTAAATTCGTCATTTTCCTAGTCAAACGGCG
JMSF041C03+ ATAAGACGGAAATATGGAAAAGCACCGGAGTAAATTNGTCATTTTCCTAGTCAAACGGCG
JMFF012P04+ ATAAGACGGAAATATGGAAAAGCACCGGAGTAAATTCGTCATTTTCCTAGTCAAACGGCG
                      ____________________________________________________________
consensus ATAAGACGGAAATATGGAAAAGCACCGGAGTAAATTCGTCATTTTCCTAGTCAAACGGCG
 
. : . : . : . : . : . :
JMFS160D06+ GTTAACAGTGATGGAGGGAAAGAAAGGCAGTTGAGATTTTCGACTTCCCGGCCAAAGGTC
JMFS023G12+ GTTAACAGTGATGGAGGGAAAGAAAGGCAGTTGAGATTTTCGACTTCCCGGCCAAAGGTC
JMFS017D11+ GTTAACAGTGATGGAGGGAAAGAAAGGCAGTTGAGATTTTCGACTTCCCGGCCAAAGGTC
JMFF036L20+ GTTAACAGTGATGGAGGGAAAGAAAGGCAGTTGAGATTTTCGACTTCCCGGCCAAAGGTC
JMSF041C03+ GTTNACAGTGATGGAGGGAAAGAAAGGCAGTTGAGATTTTCGACTTCCCGGCCAAAGGTC
JMFF012P04+ GTTAACAGTGATGGAGGGAAAGAAAGGCAGTTGAGATTTTCGACTTCCCGGCCAAAGGTC
                      ____________________________________________________________
consensus GTTAACAGTGATGGAGGGAAAGAAAGGCAGTTGAGATTTTCGACTTCCCGGCCAAAGGTC
 
. : . : . : . : . : . :
JMFS160D06+ CGGTAAAGTAATCGTTAAAACGTCAAAGAGTTGGTCAACATTGGAGTGTCACTGTGGCGC
JMFS023G12+ CGGTAAAGTAATCGTTAAAACGTCAAAGAGTTGGTCAACATTGGAGTGTCACTGTGG
JMFS017D11+ CGGTAAAGTAATCGTTAAAACGTCAAAGAGTTGGTCAACATTGGAGTGTCACTGTGGCGC
JMFF036L20+ CGGTAAAGTAATCGTTAAAACGTCAAAGAGTTGGTCAACATTGGAGTGTCACTGTGGCGC
JMSF041C03+ CGGTAAAGTNATCGTTAAAACGTCAAAGAGTTGGTCAACATTGGAGTGTCACTGTGGCGC
JMFF012P04+ CGGTAAAGTAATCGTTAAAACGTCAAAGAGTTGGTCAACATTGGAGTGTCACTGTGGCGC
                      ____________________________________________________________
consensus CGGTAAAGTAATCGTTAAAACGTCAAAGAGTTGGTCAACATTGGAGTGTCACTGTGGCGC
 
. : . : . : . : . : . :
JMFS160D06+ ACGGAGTACGAGAAAGAGAGA-GAGACAGCT
JMFS017D11+ ACGGAGTACGAGAAAGAGAGA-GAGACAGCTATATA
JMFF036L20+ ACGGAGTACGAGAAAGAGAGA-GAGACAGCTATATAAATGACAACTGAAGGGTCAGT
JMSF041C03+ ACGGAGTACGAGAAAGAGAGATGAGACAGCTATATAAANGACAACTGAAGGNTCAGT
JMFF012P04+ ACGGAGTACGAGAAAGAGAGA-GAGACAGCTATATAAATGACAACTGAAGGGTCAGTACT
                      ____________________________________________________________
consensus ACGGAGTACGAGAAAGAGAGA-GAGACAGCTATATAAATGACAACTGAAGGGTCAGTACT