Previous Contig 000681:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012P02Sequence305000681 (2)
JMFS051C01Sequence599000681 (2)gb:AF353092_17905382e-04Arabidopsis thaliana BEL1-like homeobox 4 (BLH4) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS051C01+ CCGACAACATCCCCGACGTTTCATTACTTCCGGCAAGCCCCACCGGATGCTCATCTTCTT
                      ____________________________________________________________
consensus CCGACAACATCCCCGACGTTTCATTACTTCCGGCAAGCCCCACCGGATGCTCATCTTCTT
 
. : . : . : . : . : . :
JMFS051C01+ CTTCAACCTGCTGCGGCGGCGCCGGCGGCACCTTATCCCGCCGGATCTGCTGCAGAATTT
                      ____________________________________________________________
consensus CTTCAACCTGCTGCGGCGGCGCCGGCGGCACCTTATCCCGCCGGATCTGCTGCAGAATTT
 
. : . : . : . : . : . :
JMFS051C01+ CTGCCGGCGATCTCTCGAACCCGTTCGAGAAACTGAACAATCCAGGATGATGATGATAAT
                      ____________________________________________________________
consensus CTGCCGGCGATCTCTCGAACCCGTTCGAGAAACTGAACAATCCAGGATGATGATGATAAT
 
. : . : . : . : . : . :
JMFS051C01+ CTTGGGACATAGATAGATATATACCTTAACCCAACAAATCCAAACAACCTAAGCCTTTCC
                      ____________________________________________________________
consensus CTTGGGACATAGATAGATATATACCTTAACCCAACAAATCCAAACAACCTAAGCCTTTCC
 
. : . : . : . : . : . :
JMFS051C01+ TAGTAAGCAAGAGTTGTTGAACTCCACTGTACCACATCCATGGCTGCGCTCTTAATTGAG
                      ____________________________________________________________
consensus TAGTAAGCAAGAGTTGTTGAACTCCACTGTACCACATCCATGGCTGCGCTCTTAATTGAG
 
. : . : . : . : . : . :
JMFS051C01+ AATTTCAGGCTGTAAAAGGGTCTCAGACATCGCTTTCTCCTCTCCTCAAGAATTTTTTTT
JMFF012P02+ TTTTT
                      ____________________________________________________________
consensus AATTTCAGGCTGTAAAAGGGTCTCAGACATCGCTTTCTCCTCTCCTCAAGAATTTTTTTT
 
. : . : . : . : . : . :
JMFS051C01+ TTTTTCTTTTTTTCTTTCTCTTTCTGAGCCTGTCCTCTCTCTGTCTGTCTCTCTCCTTTT
JMFF012P02+ TTTTTCTTTTTTTCCTTCTCTTTCTGAGCCTGTCCTCTCTCTGTCTGTCTCTCTCCTTTT
                      ____________________________________________________________
consensus TTTTTCTTTTTTTCTTTCTCTTTCTGAGCCTGTCCTCTCTCTGTCTGTCTCTCTCCTTTT
 
. : . : . : . : . : . :
JMFS051C01+ CTCACTCTTTTGTTGCTACTTGCAGTGAGTGCTAGCTTTCTCTGCAATCGCCTTCTGGGA
JMFF012P02+ CTCACTCTTTTGTTGCTACTTGCAGTGAGTGCTAGCTTTCTCTGCAATCGCCTTCTGGGA
                      ____________________________________________________________
consensus CTCACTCTTTTGTTGCTACTTGCAGTGAGTGCTAGCTTTCTCTGCAATCGCCTTCTGGGA
 
. : . : . : . : . : . :
JMFS051C01+ AAGTGAAATCATCCAAACTAACAACAAAGGAGTGGGTATATGTATACGGAGTGTAACATC
JMFF012P02+ AAGTGAAATCATCCAAACTAACAACAAAGGAGTGGGTATATGTATACGGAGTGTAACATC
                      ____________________________________________________________
consensus AAGTGAAATCATCCAAACTAACAACAAAGGAGTGGGTATATGTATACGGAGTGTAACATC
 
. : . : . : . : . : . :
JMFS051C01+ TCAAGTGTACAGGTGAAAATCTGTGAACTTATAATCTTTCATCTCTCTTCAGTTCTTTG
JMFF012P02+ TCAAGTGTACAGGTGAAAATCTGTGAACTTATAATCTTTCATCTCTCTTCAGTTCTTTGA
                      ____________________________________________________________
consensus TCAAGTGTACAGGTGAAAATCTGTGAACTTATAATCTTTCATCTCTCTTCAGTTCTTTGA
 
. : . : . : . : . : . :
JMFF012P02+ TGAGCAGCTAGAGAGAGAGAGAGAGAGAGTGGGGATGATAGGGAGAGGGAGAGAAGAGGT
                      ____________________________________________________________
consensus TGAGCAGCTAGAGAGAGAGAGAGAGAGAGTGGGGATGATAGGGAGAGGGAGAGAAGAGGT