Previous Contig 000680:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005B07Sequence430000680 (8)gb:AC120986_17400054e-32Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1781_H11, complete s641000680 (8)gb:AP003284_18272482e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMFF012O22Sequence561000680 (8)pir|T04903|T049034e-59iron-sulfur cofactor synthesis protein nifU homolog T10I14.50 [similarity] - Ara742000680 (8)gb:AP003284_18272484e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMFF025M05Sequence549000680 (8)pir|T04903|T049032e-56iron-sulfur cofactor synthesis protein nifU homolog T10I14.50 [similarity] - Ara717000680 (8)gb:AP003284_18272484e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMFN012J04Sequence604000680 (8)gb:AP003284_18272488e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMFN015A16Sequence628000680 (8)gb:AP003284_18272482e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN015A16+ TTCAGGCAAACTTAATTAGCATCAGCAGCTTTCTCCAGCGCCACTGCTTGTTCT
JMFN012J04+ CCAGCGCCACTGCTTGTTCT
                      ____________________________________________________________
consensus TTCAGGCAAACTTAATTAGCATCAGCAGCTTTCTCCAGCGCCACTGCTTGTTCT
 
. : . : . : . : . : . :
JMFN015A16+ GTTGGAGATGATTTTGCTCGCTTCGCCTCATAATCCTTCACCGCTGCCTTTATTGCATCC
rJMFF025M05- GCCTCATAATCCTTCACCGCTGCCTTTATTGCATCC
rJMFF005B07- CCTCATAATCCTTCACCGCCGCCTTTATTGCATCC
JMFN012J04+ GTTGGAGATGATTTTGCTCGCTTCGCCTCATAATCCTTCACCGCTGCCTTTATTGCATCC
rJMFF012O22- GCCTCATAATCCTTCACCGCTGCCTTTATTGCATCC
JMFF025M05+ CTTTATTGCATCC
JMFF012O22+ CTTCACCGCTGCCTTTATTGCATCC
                      ____________________________________________________________
consensus GTTGGAGATGATTTTGCTCGCTTCGCCTCATAATCCTTCACCGCTGCCTTTATTGCATCC
 
. : . : . : . : . : . :
JMFN015A16+ TCTGCCAGCATGCTACAGTGGAGCTTAACGGGAGGGAGGGAGAGATGCTTGGCAATTTCT
rJMFF025M05- TCTGCCAGCATGCTACAGTGGAGCTTAACGGGAGGGAGGGAGAGATGCTTGGCAATTTCT
rJMFF005B07- TCGGCCAGCATGCTACAGTGGAGCTTAACGGGAGGGAGGGAAAGATGCTTGGCAATTTCC
JMFN012J04+ TCTGCCAGCATGCTACAGTGGAGCTTAACGGGAGGGAGGGAGAGATGCTTGGCAATTTCT
rJMFF012O22- TCTGCCAGCATGCTACAGTGGAGCTTAACGGGAGGGAGGGAGAGATGCTTGGCAATTTCT
JMFF025M05+ TCTGCCAGCATGCTACAGTGGAGCTTAACGGGAGGGAGGGAGAGATGCTTGGCAATTTCT
JMFF012O22+ TCTGCCAGCATGNTACAGTGGAGCTTAACGGGAGGGAGGGAGAGATGCTTGGCAATTTCT
                      ____________________________________________________________
consensus TCTGCCAGCATGCTACAGTGGAGCTTAACGGGAGGGAGGGAGAGATGCTTGGCAATTTCT
 
. : . : . : . : . : . :
JMFN015A16+ GTATTCTTGATGGTTAGAACCTCCTCCATCTGTTTCCCCTTCACCCACTCTGTAGCTACA
rJMFF025M05- GTATTCTTGATGGTTAGAACCTCCTCCATCTGTTTCCCCTTCACCCACTCTGTAGCTACA
rJMFF005B07- GTATTCTTGATGGTTAGAACCTCCTCCATCTGTTTCCCCTTCACCCACTCTGTTGCTACG
JMFN012J04+ GTATTCTTGATGGTTAGAACCTCCTCCATCTGTTTCCCCTTCACCCACTCTGTAGCTACA
rJMFF012O22- GTATTCTTGATGGTTAGAACCTCCTCCATCTGTTTCCCCTTCACCCACTCTGTAGCTACA
JMFF025M05+ GTATTCTTGATGGTTAGAACCTCCTCCATCTGTTTCCCCTTCACCCACTCTGTAGCTACA
JMFF012O22+ GTATTCTTGATGGTTAGAACCTCCTCCATCTGTTTCCCCTTCACCCACTCTGTAGCTACA
                      ____________________________________________________________
consensus GTATTCTTGATGGTTAGAACCTCCTCCATCTGTTTCCCCTTCACCCACTCTGTAGCTACA
 
. : . : . : . : . : . :
JMFN015A16+ GAGGAGGAGGCGATAGCGGAACCACAGCCGAAGGTCTTGAAGCAGGCGTCAACGATCTTC
rJMFF025M05- GAGGAGGAGGCGATAGCGGAACCACAGCCGAAGGTCTTGAAGCAGGCGTCAACGATCTTC
JMFF005B07+ GAGGAGGAGGCGATGGCGGAACCGCAGCCGAAGGTCTTGAAGCAGGCGTCAACGATCTTC
rJMFF005B07- GAGGAGGAGGCGATGGCGGAACCGCAGCCGAAGGTCTTGAAGCAGGCGTCAACGATCTTC
JMFN012J04+ GAGGAGGAGGCGATAGCGGAACCACAGCCGAAGGTCTTGAAGCAGGCGTCAACGATCTTC
rJMFF012O22- GAGGAGGAGGCGATAGCGGAACCACAGCCGAAGGTCTTGAAGCAGGCGTCAACGATCTTC
JMFF025M05+ GAGGAGGAGGCGATAGCGGAACCACAGCCGAAGGTCTTGAAGCAGGCGTCAACGATCTTC
JMFF012O22+ GAGGAGGAGGCGATAGCGGAACCACAGCCGAAGGTCTTGAAGCAGGCGTCAACGATCTTC
                      ____________________________________________________________
consensus GAGGAGGAGGCGATAGCGGAACCACAGCCGAAGGTCTTGAAGCAGGCGTCAACGATCTTC
 
. : . : . : . : . : . :
JMFN015A16+ CCACTCTCATCATCGACCTTAATCTGAAGCTTCATCACGTCGCCGCAGGCCGGGGCGCCG
rJMFF025M05- CCACTCTCATCATCGACATTAATCTGAAGCTTCATCACGTCGCCGCAGGCCGGGGCGCCG
JMFF005B07+ CCACTTTCATCATCGACCTTAATCTGAAGCTTCATCACGTCGCCGCAGGCCGGGGCGCCG
rJMFF005B07- CCACTTTCATCATCGACCTTAATCTGAAGCTTCATCACGTCGCCGCAGGCCGGGGCGCCG
JMFN012J04+ CCACTCTCATCATCGACCTTAATCTGAAGCTTCATCACGTCGCCGCAGGCCGGGGCGCCG
rJMFF012O22- CCACTCTCATCATCGACATTAATCTGAAGCTTCATCACGTCGCCGCAGGCCGGGGCGCCG
JMFF025M05+ CCACTCTCATCATNGACATTAATCTGAAGCTTCATCACGTCGCCGCAGGCCGGGGNGCCG
JMFF012O22+ CCACTCTCATCATCGACATTAATCTGAAGCTTCATCACGTCGCCGCAGGCCGGGGCGCCG
                      ____________________________________________________________
consensus CCACTCTCATCATCGACCTTAATCTGAAGCTTCATCACGTCGCCGCAGGCCGGGGCGCCG
 
. : . : . : . : . : . :
JMFN015A16+ ACCAATCCGGTGCCGACGGTGGGGTCGTTCTTGTCGAAGGAGCCGACATTGCGGGGGTT-
rJMFF025M05- ACCAATCCGGTGCCGACGGTGGGGTCGTTCTTGTCGAAGGAGCCGACATTGCGGGGGTT-
JMFF005B07+ ACCAACCCAGTACCGACGGTGGGGTCGTTCTTGTCAAAGGAGCCGACATTGCGGGGGTT-
rJMFF005B07- ACCAACCCAGTACCGACGGTGGGGTCGTTCTTGTCAAAGGAGCCGACATTGCGGGGGTTG
JMFN012J04+ ACCAATCCGGTGCCGACGGTGGGGTCGTTCTTGTCGAAGGAGCCGACATTGCGGGGGTT-
rJMFF012O22- ACCAATCCGGTGCCGACGGTGGGGTCGTTCTTGTCGAAGGAGCCGACATTGCGGGGGTT-
JMFF025M05+ ACCAATCCGGTGCCGACGGTGGGGTCGTTCTTGTCGAAGGAGCCGACATTGCGGGGGTT-
JMFF012O22+ ACCAATCCGGTGCCGACGGTGGGGTCGTTCTTGTCGAAGGAGCCGACATTGCGGGGGTT-
                      ____________________________________________________________
consensus ACCAATCCGGTGCCGACGGTGGGGTCGTTCTTGTCGAAGGAGCCGACATTGCGGGGGTT-
 
. : . : . : . : . : . :
JMFN015A16+ GTTGTAGTGGTCCACCACCCTCTCGTGGTAGAGCCGCGGCAGCCCCGCCGTGGCCCTCTC
rJMFF025M05- GTTGTAGTGGTCCACCACCCTCTCGTGGTAGAGCCGCGGCAGCCCCGCCGTGGCCCTCTC
JMFF005B07+ GTTGTAGTGGTCCACCACCCTCTCGTGGTAGAGCCGCGGCA
rJMFF005B07- GTTGTAGTGGTCCACCACCCTCTCGTGGTAGAGCCGCGGCAGCCCCGCCGTGGCCCTCTC
JMFN012J04+ GTTGTAGTGGTCCACCACCCTCTCGTGGTAGAGCCGCGGCAGCCCCGCCGTGGCCCTCTC
rJMFF012O22- GTTGTAGTGGTCCACCACCCTCTCGTGGTAGAGCCGCGGCAGCCCCGCCGTGGCCCTCTC
JMFF025M05+ GTTGTAGTGGTCCACCACCCTCTCGTGGTAGAGCCGCGGCAGCCCCGCCGTGGCCCTCTC
JMFF012O22+ GTTGTAGTGGTCCACCACCCTCTCGTGGTAGAGCCGCGGCAGCCCCGCCGTGGCCCTCTC
                      ____________________________________________________________
consensus GTTGTAGTGGTCCACCACCCTCTCGTGGTAGAGCCGCGGCAGCCCCGCCGTGGCCCTCTC
 
. : . : . : . : . : . :
JMFN015A16+ C---GCCGCCGCAACTCGCGGCGCCAGCCCTAGAACTCTGTTGGCGGCAAGCTTCAACAT
rJMFF025M05- C---GCCGCCGCAACTCGCGGCGCCAGCCCTAGAACTCTGTTGGCGGCAAGCTTCAACAT
rJMFF005B07- CGCCGCCGCCGCAACTCGCGGCGCCAGCCCTAGAACTCTGTTGCCCGCAAGCTTCAACAT
JMFN012J04+ C---GCCGCCGCAACTCGCGGCGCCAGCCCTAGAACTCTGTTGGCGGCAAGCTTCAACAT
rJMFF012O22- C---GCCGCCGCAACTCGCGGCGCCAGCCCTAGAACTCTGTTGGCGGCAAGCTTCAACAT
JMFF025M05+ C---GCCGCCGCAACTCGCGGCGCCAGCCCTAGAACTCTGTTGGCGGCAAGCTTCAACAT
JMFF012O22+ C---GCCGCCGCAACTCGCGGCGCCAGCCCTAGAACTCTGTTGGCGGCAAGCTTCAACAT
                      ____________________________________________________________
consensus C---GCCGCCGCAACTCGCGGCGCCAGCCCTAGAACTCTGTTGGCGGCAAGCTTCAACAT
 
. : . : . : . : . : . :
JMFN015A16+ TCTTGCCGAATTAATCGTTGATAATTTCGGGAAATTCGCGTTAACGATTTCTTTGTAGGA
rJMFF025M05- TCTTGCCGAATTAATCGTTGATAATTTCGGGAAATTCGCGTTAACGATTTCTTTGTAGGA
rJMFF005B07- TCTTGCGGAATTGGTCGTTGATAATTT
JMFN012J04+ TCTTGCCGAATTAATCGTTGATAATTTCGGGAAATTCGCGTTAACGATTTCTTTGTAGGA
rJMFF012O22- TCTTGCCGAATTAATCGTTGATAATTTCGGGAAATTCGCGTTAACGATTTCTTTGTAGGA
JMFF025M05+ TCTTGCCGAATTAATCGTTGATAATTTCGGGAAATTCGCGTTAACGATTTCTTTGTAGGA
JMFF012O22+ TCTTGCCGAATTAATCGTTGATAATTTCGGGAAATTCGCGTTAACGATTTCTTTGTAGGA
                      ____________________________________________________________
consensus TCTTGCCGAATTAATCGTTGATAATTTCGGGAAATTCGCGTTAACGATTTCTTTGTAGGA
 
. : . : . : . : . : . :
JMFN015A16+ TTGAAATTGTTTGTTTGATTTCTGGGAGATAATTTTAG
rJMFF025M05- TTGAAATTGTTTGTTTGATTTCTGGGAGATA
JMFN012J04+ TTGAAATTGTTTGTTTGATTTCTGGGAGATAATTTTAGGTTAGTTGAA
rJMFF012O22- TTGAAATTGTTTGTTTGATTTCTGGGAGATAATTTTAGGNTAGTTGAA
JMFF025M05+ TTGAAATTGTTTGTTTGATTTCTGGGAGATAATTTTAGGTTAGTTGAAGTGCGTA
JMFF012O22+ TTGAAATTGTTTGTTTGATTTCTGGGAGATAATTTTAGGTTAGTTGAAGTGCGTAAATGC
                      ____________________________________________________________
consensus TTGAAATTGTTTGTTTGATTTCTGGGAGATAATTTTAGGTTAGTTGAAGTGCGTAAATGC