Previous Contig 000677:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004A05Sequence553000677 (14)sp|P54778|PRS6_SOLTU2e-5426S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT767010309 (15)sp|P54778|PRS6_SOLTUe-10326S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMFF007K02Sequence566000677 (14)sp|P54778|PRS6_SOLTU3e-6326S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT759010309 (15)sp|P54778|PRS6_SOLTUe-10426S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMFF012O05Sequence571000677 (14)sp|P54778|PRS6_SOLTU3e-5526S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT727010309 (15)sp|P54778|PRS6_SOLTU1e-8826S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMFF013F01Sequence540000677 (14)sp|P54778|PRS6_SOLTU4e-5726S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT626010309 (15)sp|P54778|PRS6_SOLTU2e-7526S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMFF023E21Sequence548000677 (14)sp|P54778|PRS6_SOLTU2e-5826S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMFF024B02Sequence477000677 (14)sp|P54778|PRS6_SOLTU5e-4626S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT777010309 (15)sp|P54778|PRS6_SOLTUe-10226S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMFF029J03Sequence484000677 (14)sp|P54778|PRS6_SOLTU7e-4726S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT742010309 (15)sp|P54778|PRS6_SOLTU5e-9426S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMFF031A12Sequence588000677 (14)sp|P54778|PRS6_SOLTU4e-6326S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT770010309 (15)sp|P54778|PRS6_SOLTUe-10426S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMFF038A01Sequence557000677 (14)sp|P54778|PRS6_SOLTU4e-6026S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT359010309 (15)gb:CAR6095_16454341e-22Cicer arietinum mRNA for putative 26S protease regulatory subunit 6, partial.
JMFF043C18Sequence641000677 (14)sp|P54778|PRS6_SOLTU3e-7626S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT610010309 (15)sp|P54778|PRS6_SOLTU5e-6726S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMFF043G18Sequence648000677 (14)sp|P54778|PRS6_SOLTU6e-7926S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT638010309 (15)sp|P54778|PRS6_SOLTU1e-6426S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMSF006L04Sequence369000677 (14)sp|P54778|PRS6_SOLTU3e-2626S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT387010309 (15)sp|P54778|PRS6_SOLTU2e-4526S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMSF039G10Sequence670000677 (14)sp|P54778|PRS6_SOLTU3e-8426S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT903010309 (15)sp|P54778|PRS6_SOLTUe-11426S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT
JMSF041A24Sequence769000677 (14)sp|P54778|PRS6_SOLTU6e-9726S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT656010309 (15)sp|P54778|PRS6_SOLTU4e-8326S protease regulatory subunit 6B homolog.>pir|T07110|T07110 vacuolar proton-AT

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041A24+ TAATGAAAGATGCCGTTGTGTGGTTAGCAACA
                      ____________________________________________________________
consensus TAATGAAAGATGCCGTTGTGTGGTTAGCAACA
 
. : . : . : . : . : . :
JMSF041A24+ GCCTTTGCAAGCATAGTTTTTACCAGTACCTGGAGGACCATAGAGTAAGACACCACGGGG
                      ____________________________________________________________
consensus GCCTTTGCAAGCATAGTTTTTACCAGTACCTGGAGGACCATAGAGTAAGACACCACGGGG
 
. : . : . : . : . : . :
JMSF039G10+ GGATCTATACCGATCTGTTTGTACAACTCATGATGAGTCAAAGGTAACTCCACTGCCTC
JMSF041A24+ AGGATCTATACCGATCTGTTTGTACAACTCATGATGAGTCAAAGGTAACTCCACTGCCTC
JMFF043G18+ CATGATGAGTCAAAGGTAACTCCACTGCCTC
JMFF043C18+ AGTCAAAGGTAACTCCACTGCCTC
                      ____________________________________________________________
consensus AGGATCTATACCGATCTGTTTGTACAACTCATGATGAGTCAAAGGTAACTCCACTGCCTC
 
. : . : . : . : . : . :
JMSF039G10+ ACGGATTTCCTGCTTCTGAATGTCACATCCTCCAATATCATTGTAGGTGACATCGGGCTT
JMSF041A24+ ACGGATTTCCTGCTTNTGAATGTCACATCCTCCAATATCATTGTAGGTGACATCGGGCTT
JMFF043G18+ ACGGATTTCCTGCTTCTGAATGTCACATCCTCCAATATCATTGTAGGTGACATCGGGCTT
JMFF043C18+ ACGGATTTCCTGCTTCTGAATGTCACATCCTCCAATATCATNGTAGGTGACATCGGGCTT
JMFF007K02+ AGGTGACATCGGGCTT
JMFF038A01+ T
JMFF031A12+ TAGGTGACATCGGGCTT
                      ____________________________________________________________
consensus ACGGATTTCCTGCTTCTGAATGTCACATCCTCCAATATCATTGTAGGTGACATCGGGCTT
 
. : . : . : . : . : . :
JMSF039G10+ TTCAGATTGGCTGAGCAACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
JMSF041A24+ TTCAGATTGGCTGAGCAACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
JMFF043G18+ TTCAGATTGGCTGAGCAACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
JMFF043C18+ TTCAGATTGGCTGAGCAACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
JMFF007K02+ TTCAGATTGGCTGAGCAACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
JMFF038A01+ TTCAGATTGGCTGAGCAACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
JMFF023E21+ GGCTGAGCAACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
JMFF013F01+ AACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
JMFF031A12+ TTCAGATTGGCTGAGCAACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
JMFF004A05+ TCAGCTTCCGGAGGAAGCACATCGACAAG
JMFF012O05+ AGTCAGCTTCCGGAGGAAGCACATCGACAAG
                      ____________________________________________________________
consensus TTCAGATTGGCTGAGCAACGAAATACTGGAGTCAGCTTCCGGAGGAAGCACATCGACAAG
 
. : . : . : . : . : . :
JMSF039G10+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMSF041A24+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF043G18+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF043C18+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF007K02+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF038A01+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF023E21+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF013F01+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF031A12+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF029J03+ GCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF024B02+ AATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF004A05+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
JMFF012O05+ GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
                      ____________________________________________________________
consensus GGCATTCGAGTGGCGGTGCAATGCAACAGAAGCCGAGGGCTTGAGAAGCTCCCGATTGAT
 
. : . : . : . : . : . :
JMSF039G10+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMSF041A24+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF043G18+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF043C18+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF007K02+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF038A01+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF023E21+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF013F01+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF031A12+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF029J03+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF024B02+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF004A05+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
JMFF012O05+ GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
                      ____________________________________________________________
consensus GGTGCTAAGAATCCGGACATAGTAATTGGAGCCGGTGGTGGAACCGACAATCGCGTTGTT
 
. : . : . : . : . : . :
JMSF039G10+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMSF041A24+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF043G18+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF043C18+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF007K02+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF038A01+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF023E21+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF013F01+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF031A12+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF029J03+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF024B02+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMSF006L04+ TCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF004A05+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
JMFF012O05+ CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
                      ____________________________________________________________
consensus CTGGTCAATCATCTCCATAAACTGCCCTATCACGAGCGGCACCGACTGGATCCGCTTGAC
 
. : . : . : . : . : . :
JMSF039G10+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMSF041A24+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF043G18+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF043C18+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF007K02+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF038A01+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF023E21+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF013F01+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF031A12+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF029J03+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF024B02+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMSF006L04+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF004A05+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
JMFF012O05+ CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
                      ____________________________________________________________
consensus CTCCTCCTGCGCCCGGAGGTGCTCCCGCCTCAGATTCTTCAGCTCATCCTTCACGTACTC
 
. : . : . : . : . : . :
JMSF039G10+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMSF041A24+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF043G18+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF043C18+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF007K02+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF038A01+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF023E21+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF013F01+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF031A12+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF029J03+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF024B02+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMSF006L04+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF004A05+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
JMFF012O05+ CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
                      ____________________________________________________________
consensus CTCTTGGATCTCTATAAACTCCAGCTGCCGCTCCAGGGATTTCAGCCGCGAGTAGAGATC
 
. : . : . : . : . : . :
JMSF039G10+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMSF041A24+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF043G18+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF043C18+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF007K02+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF038A01+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF023E21+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF013F01+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF031A12+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF029J03+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF024B02+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMSF006L04+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF004A05+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
JMFF012O05+ GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
                      ____________________________________________________________
consensus GTCATCGGCGTCGGAAGAGAGGTCGTGAGTCGATGTACCGGATCGAGTCGCCGGCAGCTC
 
. : . : . : . : . : . :
JMSF039G10+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMSF041A24+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF043G18+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF043C18+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF007K02+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF038A01+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF023E21+ CNAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF013F01+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF031A12+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF029J03+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF024B02+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMSF006L04+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF004A05+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
JMFF012O05+ CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
                      ____________________________________________________________
consensus CAAAACCATCGGCTTTGGAGTTGGATTTGGGTCCAGAACCATCGGCGTCGCCATTCTTTA
 
. : . : . : . : . : . :
JMSF039G10+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMSF041A24+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF043G18+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF043C18+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF007K02+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF038A01+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF023E21+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF013F01+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF031A12+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF029J03+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF024B02+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMSF006L04+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF004A05+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
JMFF012O05+ CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
                      ____________________________________________________________
consensus CGCTTCTTTTCTGCTTGATGTCGTCGATAACTTCGGCCGTCGGAGCTTCGTTTTGGCGTA
 
. : . : . : . : . : . :
JMSF039G10+ GAAAGCAATC
JMSF041A24+ GAAAGCAATCAAAAGT
JMFF043G18+ GAAAGCAATCAAAAGT
JMFF043C18+ GAAAGCAATCAAAAGT
JMFF007K02+ GAAAGCAATC
JMFF038A01+ GAAAGCAATCAAAAGT
JMFF023E21+ GAAAGCAATCATAAGT
JMFF013F01+ GAAAGCAATCAAAAGT
JMFF031A12+ GAAAGCAATCAAAAGTGGAAACTTGACA
JMFF029J03+ GAAAGCAATCAAAAGT
JMFF024B02+ GAAAGCAATCAAAAGT
JMSF006L04+ GAAAGCAATCAAAAG
JMFF004A05+ GAAAGCAATCAAAAGTGGAAACTTGACAGAGAGACCCGAT
JMFF012O05+ GAAAGCAATCAAAAGTGGAAACTTGACAGAGAGACCCGATTGATGACGAATAGGCTAACT
                      ____________________________________________________________
consensus GAAAGCAATCAAAAGTGGAAACTTGACAGAGAGACCCGATTGATGACGAATAGGCTAACT