Previous Contig 000674:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006K11Sequence545000674 (19)gb:AB052291_15212102e-47Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd696008452 (14)gb:AY082335_15691551e-31Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFF012N12Sequence496000674 (19)pir|T50645|T506453e-41glucan endo-1,3-beta-D-glucosidase (EC 3.2.1.39) [imported] - garden pea>gb:PSA2674008452 (14)gb:AY082335_15691551e-31Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFF027E01Sequence494000674 (19)pir|T50645|T506453e-41glucan endo-1,3-beta-D-glucosidase (EC 3.2.1.39) [imported] - garden pea>gb:PSA2680008452 (14)gb:AY082335_15691551e-31Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFF027M10Sequence495000674 (19)pir|T50645|T506453e-41glucan endo-1,3-beta-D-glucosidase (EC 3.2.1.39) [imported] - garden pea>gb:PSA2676008452 (14)gb:AY082335_15691551e-31Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFF032E10Sequence497000674 (19)gb:AB052291_15212102e-35Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd646008452 (14)gb:AY082335_15691551e-32Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFF032J06Sequence546000674 (19)gb:AB052291_15212102e-47Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd767008452 (14)gb:AF249675_17807794e-34Olea europaea beta-1,3-glucanase-like protein (OLE9) mRNA, complete cds.
JMFF033D22Sequence492000674 (19)pir|T50645|T506453e-41glucan endo-1,3-beta-D-glucosidase (EC 3.2.1.39) [imported] - garden pea>gb:PSA2641008452 (14)gb:AY082335_15691554e-32Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFF036J01Sequence494000674 (19)pir|T50645|T506453e-41glucan endo-1,3-beta-D-glucosidase (EC 3.2.1.39) [imported] - garden pea>gb:PSA2606008452 (14)gb:AY082335_15691551e-31Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFF037P11Sequence496000674 (19)gb:AB052291_15212102e-35Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd654008452 (14)gb:AY082335_15691551e-31Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFF039E11Sequence496000674 (19)gb:AB052291_15212102e-35Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd651008452 (14)gb:AY082335_15691551e-31Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFF046M01Sequence589000674 (19)gb:AB052291_15212101e-49Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd
JMFF051I08Sequence616000674 (19)gb:AB052291_15212105e-55Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd512008452 (14)gb:AY082335_15691556e-21Olea europaea allergen Ole e 10 mRNA, complete cds.
JMFN028O07Sequence563000674 (19)gb:AB052291_15212105e-53Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd
JMFS002D07Sequence472000674 (19)pir|T50645|T506452e-41glucan endo-1,3-beta-D-glucosidase (EC 3.2.1.39) [imported] - garden pea>gb:PSA2
JMFS060G05Sequence642000674 (19)gb:AB052291_15212104e-66Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd
JMFS084H10Sequence637000674 (19)gb:AB052291_15212105e-62Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd
JMFS144E02Sequence616000674 (19)gb:AB052291_15212102e-56Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd
JMSF029D18Sequence689000674 (19)gb:AB052291_15212101e-73Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd772008452 (14)sp|P52409|E13B_WHEAT4e-44Glucan endo-1,3-beta-glucosidase precursor (EC 3.2.1.39) ((1->3)-beta- glucan en
JMSF029L14Sequence664000674 (19)gb:AB052291_15212109e-65Pyrus pyrifolia bgn-1 mRNA for endo-1,3-beta-glucanase-like protein, complete cd711008452 (14)gb:AF249675_17807793e-33Olea europaea beta-1,3-glucanase-like protein (OLE9) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029D18+ ATCGAACATGTTTCCGTACGTCCGCCGGGAGAACCGGTCCAC
                      ____________________________________________________________
consensus ATCGAACATGTTTCCGTACGTCCGCCGGGAGAACCGGTCCAC
 
. : . : . : . : . : . :
JMSF029D18+ GTATCCCTTGTTCGGCCGGAATAAGGCCAGATCCGCTTTATCCGGGGCGTACCCGAAGTA
JMFS060G05+ ATAAGGCCAGATCCGCTTTATCCGGGGCGTACCCGAAGTA
JMFS084H10+ AGTA
JMSF029L14+ ATCCGGGGCGTACCCGAAGTA
                      ____________________________________________________________
consensus GTATCCCTTGTTCGGCCGGAATAAGGCCAGATCCGCTTTATCCGGGGCGTACCCGAAGTA
 
. : . : . : . : . : . :
JMSF029D18+ CGGATACGGGTTAACCATAAACGGCCCGTTAGTTTCCCGGAGAAACTTGAGCATCGGGGC
JMFS060G05+ CGGATACGGGTTAACCATAAACGGCCCGTTAGTTTCCCGGAGAAACTTGAGCATCGGGGC
JMFS084H10+ CGGATACGGGTTAACCATAAACGGCCCGTTAGTTTCCCGGAGAAACTTGAGCATCGGGGC
JMFS144E02+ CGGCCCGTTAGTTTCCCGGAGAAACTTGAGCATCGGGGC
JMSF029L14+ CGGATACGGGTTAACCATAAACGGCCCGTTAGTTTCCCGGAGAAACTTGAGCATCGGGGC
JMFF051I08+ TTCCCGGAGAAACTTGAGCATCGGGGC
                      ____________________________________________________________
consensus CGGATACGGGTTAACCATAAACGGCCCGTTAGTTTCCCGGAGAAACTTGAGCATCGGGGC
 
. : . : . : . : . : . :
JMSF029D18+ GAGAATGCCGACATCCCAACCCGGCCTGAACCGGCCCATGCTCGGCGGGTCGGCCCGCAA
JMFS060G05+ GAGAATGCCGACATCCCAACCCGGCCTGAACCGGCCCATGCTCGGCGGGTCGGCCCGCAA
JMFS084H10+ GAGAATGCCGACATCCCAACCCGGCCTGAACCGGCCCATGCTCGGCGGGTCGGCCCGCAA
JMFS144E02+ GAGAATGCCGACATCCCAACCCGGCCTGAACCGGCCCATGCTCGGCGGGTCGGCCCGCAA
JMSF029L14+ GAGAATGCCGACATCCCAACCCGGCCTGAACCGGCCCATGCTCGGCGGGTCGGCCCGCAA
JMFN028O07+ GACATCTCAACCCGGCGTGAACCGGCCCATGCTCGGCGGGTCGGCCCGCAA
JMFF051I08+ GAGAATGCCGACATCCCAACCCGGCCTGAACCGGCCCATGCTCGGCGGGTCGGCCCGCAA
JMFF046M01+ GAGAATGCCGACAGCCCAACCCGGCNTGAACCGGCCCATGCTCGGCGGGTCGGCCCGCAA
JMFF032J06+ GGTCGGCCCGCAA
JMFF006K11+ GTCGGCCCGCAA
                      ____________________________________________________________
consensus GAGAATGCCGACATCCCAACCCGGCCTGAACCGGCCCATGCTCGGCGGGTCGGCCCGCAA
 
. : . : . : . : . : . :
JMSF029D18+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMFS060G05+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMFS084H10+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMFS144E02+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMSF029L14+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMFN028O07+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMFF051I08+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMFF046M01+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMFF032J06+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMFF027M10+ CCTTAATCCCAGATTTTACCAG
JMFF033D22+ TAATCCCAGATTTTACCAG
JMFF037P11+ CCTTAATCCCAGATTTTACCAG
JMFF039E11+ CCTTAATCCCAGATTTTACCAG
JMFF032E10+ TCCTTAATCCCAGATTTTACCAG
JMFS002D07+ TAATCCCAGATTTTACCAG
JMFF006K11+ CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
JMFF036J01+ AATCCCAGATTTTACCAG
JMFF027E01+ AATCCCAGATTTTACCAG
JMFF012N12+ TTAATCCCAGATTTTACCAG
                      ____________________________________________________________
consensus CATTATCCCCAAAGAATGCGGGCTCGAAACCTTAATCTCCTTAATCCCAGATTTTACCAG
 
. : . : . : . : . : . :
JMSF029D18+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFS060G05+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFS084H10+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFS144E02+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMSF029L14+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFN028O07+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF051I08+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF046M01+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF032J06+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF027M10+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF033D22+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF037P11+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF039E11+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF032E10+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFS002D07+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF006K11+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF036J01+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF027E01+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
JMFF012N12+ GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
                      ____________________________________________________________
consensus GGCGTTGTACAAGCTCCTCATGGCGGCGACGAGGCCGTTCTGCATCTCCGGCGTGCCCCA
 
. : . : . : . : . : . :
JMSF029D18+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFS060G05+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFS084H10+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFS144E02+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMSF029L14+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFN028O07+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF051I08+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF046M01+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF032J06+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF027M10+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF033D22+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF037P11+ GTGGAGAACCTCGTTGCCCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF039E11+ GTGGAGAACCTCGTTGCCCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF032E10+ GTGGAGAACCTCGTTGCCCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFS002D07+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF006K11+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF036J01+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF027E01+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
JMFF012N12+ GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
                      ____________________________________________________________
consensus GTGGAGAACCTCGTTG-CCGACGGCGATGATGTTGATCTTCGTGGCCGGGTAGAACGGCT
 
. : . : . : . : . : . :
JMSF029D18+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFS060G05+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFS084H10+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFS144E02+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMSF029L14+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFN028O07+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGACGTCCTTGAGGGGGATAATCTCGC
JMFF051I08+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF046M01+ TGATGTTGGCGGCGACCCTCTGGGCGGGGTATCCGGCGTCCTTGAGGTGGATAATCTTTC
JMFF032J06+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF027M10+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF033D22+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF037P11+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF039E11+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF032E10+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFS002D07+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF006K11+ TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF036J01+ TAATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF027E01+ TAATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
JMFF012N12+ TAATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
                      ____________________________________________________________
consensus TGATGTTGGCGGCGACCCACTGGGCGGCGTATCCGGCGTCCTTGAGGGGGATAATCTCGC
 
. : . : . : . : . : . :
JMSF029D18+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFS060G05+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFS084H10+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFS144E02+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMSF029L14+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFN028O07+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF051I08+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF046M01+ CGTTGGGGACGTTGACGGTGACCAGGATTCGGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF032J06+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF027M10+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF033D22+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF037P11+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF039E11+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF032E10+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFS002D07+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF006K11+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF036J01+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF027E01+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
JMFF012N12+ CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
                      ____________________________________________________________
consensus CGTTGGGGACGGTGACGGTGACCAGGATTCCGGTGCCGGCGAACGCCCGGAGAATGTCGG
 
. : . : . : . : . : . :
JMSF029D18+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFS060G05+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFS084H10+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFS144E02+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMSF029L14+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFN028O07+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF051I08+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF046M01+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF032J06+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF027M10+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF033D22+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF037P11+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF039E11+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF032E10+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFS002D07+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF006K11+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF036J01+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF027E01+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
JMFF012N12+ GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
                      ____________________________________________________________
consensus GGTTGACGTCGAAGATCTTGATGCGGTCGATGACCGTCTTTTCCTTGAGGAATCTGGCGA
 
. : . : . : . : . : . :
JMSF029D18+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFS060G05+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFS084H10+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFS144E02+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMSF029L14+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFN028O07+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF051I08+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF046M01+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTTACACCTATGGAGCGGA
JMFF032J06+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF027M10+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF033D22+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF037P11+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF039E11+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF032E10+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFS002D07+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF006K11+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF036J01+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF027E01+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
JMFF012N12+ CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
                      ____________________________________________________________
consensus CTTCCGTCGGCGGCGGGAGGTTGTCGCCCAGGGTTCCATAGTTAACACCTATGGAGCGGA
 
. : . : . : . : . : . :
JMSF029D18+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATC
JMFS060G05+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFS084H10+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFS144E02+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMSF029L14+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFN028O07+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF051I08+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF046M01+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF032J06+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF027M10+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF033D22+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF037P11+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF039E11+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF032E10+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFS002D07+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF006K11+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF036J01+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF027E01+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
JMFF012N12+ CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
                      ____________________________________________________________
consensus CGCCATGGATGAAGAGAAAAGCAGAGACGAGAAAGAAGAGAAAGATCGGAGATGGCCGCA
 
. : . : . : . : . : . :
JMFS060G05+ AAG
JMFS084H10+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGA
JMFS144E02+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTA
JMSF029L14+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTC
JMFN028O07+ AAGTACATCGTCCATTGATTTTAAGGATTAG
JMFF051I08+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTA
JMFF046M01+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTA
JMFF032J06+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGAT
JMFF027M10+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGAT
JMFF033D22+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGAT
JMFF037P11+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGAT
JMFF039E11+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAA
JMFF032E10+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGAT
JMFS002D07+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGA
JMFF006K11+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGAT
JMFF036J01+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGAT
JMFF027E01+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGAT
JMFF012N12+ AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGATGAC
                      ____________________________________________________________
consensus AAG-ACATC-TCCATT-ATTTTAAGGATTAGATTGGATTTATTCCTGTAATTAAGATGAC