Previous Contig 000672:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012N04Sequence587000672 (2)789008789 (3)
JMFF015G10Sequence583000672 (2)671008789 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF015G10+ TCAACTGCGCAGTTGGCAAAGCAGAGGCGGTGAGGTGAGGCCTGAGGCAGA
JMFF012N04+ CTGCGCAGTTGGCAAAGCAGAGGCGGTGAGGTGAGGCCTGAGGCAGA
                      ____________________________________________________________
consensus TCAACTGCGCAGTTGGCAAAGCAGAGGCGGTGAGGTGAGGCCTGAGGCAGA
 
. : . : . : . : . : . :
JMFF015G10+ AGACGGTGGCCGGTGGCGACTGGAGAGGAAGAGGCGCCGTCTGGTTGACTGTTGACGGTG
JMFF012N04+ AGACGGTGGCCGGTGGCGACTGGAGAGGAAGAGGCGCCGTCTGGTTGACTGTTGACGGTG
                      ____________________________________________________________
consensus AGACGGTGGCCGGTGGCGACTGGAGAGGAAGAGGCGCCGTCTGGTTGACTGTTGACGGTG
 
. : . : . : . : . : . :
JMFF015G10+ AGGCAGGCGCAGACGCGAGAGGCCGAGAGCAGAGGCGAGGCGAGAGGAAAAGATGAGAGC
JMFF012N04+ AGGCAGGCGCAGACGCGAGAGGCCGAGAGCAGAGGCGAGGCGAGAGGAAAAGATGAGAGC
                      ____________________________________________________________
consensus AGGCAGGCGCAGACGCGAGAGGCCGAGAGCAGAGGCGAGGCGAGAGGAAAAGATGAGAGC
 
. : . : . : . : . : . :
JMFF015G10+ AGTCTCTGAGATGGTGCCTGCTGACTCACAGCAAGTCTGCTACTCAGCTACAGGCTGACA
JMFF012N04+ AGTCTCTGAGATGGTGCCTGCTGACTCACAGCAAGTCTGCTACTCAGCTACAGGCTGACA
                      ____________________________________________________________
consensus AGTCTCTGAGATGGTGCCTGCTGACTCACAGCAAGTCTGCTACTCAGCTACAGGCTGACA
 
. : . : . : . : . : . :
JMFF015G10+ ATGGCATCTGGTATTCTGTCTAACAAGTTAACAATGCCTTATTGCCTTGAGGTACGTGAG
JMFF012N04+ ATGGCATCTGGTATTCTGTCTAACAAGTTAACAATGCCTTATTGCCTTGAGGTACGTGAG
                      ____________________________________________________________
consensus ATGGCATCTGGTATTCTGTCTAACAAGTTAACAATGCCTTATTGCCTTGAGGTACGTGAG
 
. : . : . : . : . : . :
JMFF015G10+ AAATTAGAACACCTAGTTAGGCTTCCGGCCACTTGTTGCTGCGTTTGCTGGTTGTGACTT
JMFF012N04+ AAATTAGAACACCTAGTTAGGCTTCCGGCCACTTGTTGCTGCGTTTGCTGGTTGTGACTT
                      ____________________________________________________________
consensus AAATTAGAACACCTAGTTAGGCTTCCGGCCACTTGTTGCTGCGTTTGCTGGTTGTGACTT
 
. : . : . : . : . : . :
JMFF015G10+ GTGGAGACTGCCGTCCAGGTTTGAAAGTGGTCTGAGGAACGTCGGCGGGCCGGCAGCAGC
JMFF012N04+ GTGGAGACTGCCGTCCAGGTTTGAAAGTGGTCTGAGGAACGTCGGCGGGCCGGCAGCAGC
                      ____________________________________________________________
consensus GTGGAGACTGCCGTCCAGGTTTGAAAGTGGTCTGAGGAACGTCGGCGGGCCGGCAGCAGC
 
. : . : . : . : . : . :
JMFF015G10+ AGTTCGCGGTGGACCTGGAGCCTGGCGGTGGT
JMFF012N04+ AGTTCGCGGTGGACCTGGAGCCTGGCGGTGGTCTGTGGACTATGAGACTGAGGAGTTCGC
                      ____________________________________________________________
consensus AGTTCGCGGTGGACCTGGAGCCTGGCGGTGGTCTGTGGACTATGAGACTGAGGAGTTCGC
 
. : . : . : . : . : . :
JMFF012N04+ CAATCGCAGTTGACGGCAGCCTGAGGAATGACGGGCGACGGAAACAGCAGTTCGCCTCTG
                      ____________________________________________________________
consensus CAATCGCAGTTGACGGCAGCCTGAGGAATGACGGGCGACGGAAACAGCAGTTCGCCTCTG
 
. : . : . : . : . : . :
JMFF012N04+ TGCAGCTGTGCTTAGTGGATCGATCGATAGGTTTTGAAATTTTAGGAATTGGGAATCCAC
                      ____________________________________________________________
consensus TGCAGCTGTGCTTAGTGGATCGATCGATAGGTTTTGAAATTTTAGGAATTGGGAATCCAC