Previous Contig 000664:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012J20Sequence483000664 (2)gb:ATAC010870_15431791e-33Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen750020926gb:ATAC010870_15431798e-60Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen
JMFS154E12Sequence612000664 (2)gb:ATAC010870_1543179e-106Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS154E12+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMFS154E12+ TCAGCAATACTATCAACAACCTTAACATTATTGAGATATATGGATGAATAAGGTCGATGT
                      ____________________________________________________________
consensus TCAGCAATACTATCAACAACCTTAACATTATTGAGATATATGGATGAATAAGGTCGATGT
 
. : . : . : . : . : . :
JMFS154E12+ GCATGACCATTTGAATCACAACCAAGCAGGTGTAGAAATATAGTAAGCTTATCCTGTTGA
                      ____________________________________________________________
consensus GCATGACCATTTGAATCACAACCAAGCAGGTGTAGAAATATAGTAAGCTTATCCTGTTGA
 
. : . : . : . : . : . :
JMFS154E12+ AGAAGTTGTTTCAATTCTGGGTCCTTGTTAGACCTATTCAAGAGGCTCTGGAATTGATCA
                      ____________________________________________________________
consensus AGAAGTTGTTTCAATTCTGGGTCCTTGTTAGACCTATTCAAGAGGCTCTGGAATTGATCA
 
. : . : . : . : . : . :
JMFS154E12+ AGTGACCACTCATCCAAAAAAGAAGCATCAGTAGCAAAATCTTCATAATCATGAGGGTAG
                      ____________________________________________________________
consensus AGTGACCACTCATCCAAAAAAGAAGCATCAGTAGCAAAATCTTCATAATCATGAGGGTAG
 
. : . : . : . : . : . :
JMFS154E12+ GAATTCCAAGTGCTATGCGGCAAGGCACCACAGAATATGGGAATAATGTCAGGACTGCCA
                      ____________________________________________________________
consensus GAATTCCAAGTGCTATGCGGCAAGGCACCACAGAATATGGGAATAATGTCAGGACTGCCA
 
. : . : . : . : . : . :
JMFS154E12+ AAAGCAAATGTATGCCGGCTTCTATTAAATACTGAATCAAACTCAACTGGATTTGCCTTC
                      ____________________________________________________________
consensus AAAGCAAATGTATGCCGGCTTCTATTAAATACTGAATCAAACTCAACTGGATTTGCCTTC
 
. : . : . : . : . : . :
JMFS154E12+ CAACCTTTGGTGACAGCACTAGGATCCTCGTAGAATCCAGCAATTATAGCAACATGTCCA
                      ____________________________________________________________
consensus CAACCTTTGGTGACAGCACTAGGATCCTCGTAGAATCCAGCAATTATAGCAACATGTCCA
 
. : . : . : . : . : . :
JMFS154E12+ GGCCTAGATTCTGTTGGAGGACGAGCATGCGATACTCCCCACCGGCCTTGCTCTTTAATC
JMFF012J20+ ATC
                      ____________________________________________________________
consensus GGCCTAGATTCTGTTGGAGGACGAGCATGCGATACTCCCCACCGGCCTTGCTCTTTAATC
 
. : . : . : . : . : . :
JMFS154E12+ ACACTCCTCAAAAATGGCGCTCTATAATTCCCTTCTGAATCAGGCTCAAAAAACTTATCG
JMFF012J20+ ACACTCCTCAAAAATGGCGCTCTATAATTCCCTTCTGAATCAGGCTCAAAAAACTTATCG
                      ____________________________________________________________
consensus ACACTCCTCAAAAATGGCGCTCTATAATTCCCTTCTGAATCAGGCTCAAAAAACTTATCG
 
. : . : . : . : . : . :
JMFS154E12+ GCCCGTAACCCATCAGCAATCAAGAGAACAAGACGCTTGGCGGGAGCAGAGTAGCGAGGA
JMFF012J20+ GCCCGTAACCCATCAGCAATCAAGAGAACAAGACGCTTGGCGGGAGCAGAGTAGCGAGGA
                      ____________________________________________________________
consensus GCCCGTAACCCATCAGCAATCAAGAGAACAAGACGCTTGGCGGGAGCAGAGTAGCGAGGA
 
. : . : . : . : . : . :
JMFS154E12+ GTGACGGGGTC
JMFF012J20+ GTGACGGGGTCCATGCCGTGAACAATAGGAGTTTTGAAGTAAATGTCGAAGATGCTGAGC
                      ____________________________________________________________
consensus GTGACGGGGTCCATGCCGTGAACAATAGGAGTTTTGAAGTAAATGTCGAAGATGCTGAGC
 
. : . : . : . : . : . :
JMFF012J20+ ATGTAAACTGCGTGTAAAACGATTCCCACAACCACCAGCCATTTCTCTCTCCTTTTGAGC
                      ____________________________________________________________
consensus ATGTAAACTGCGTGTAAAACGATTCCCACAACCACCAGCCATTTCTCTCTCCTTTTGAGC
 
. : . : . : . : . : . :
JMFF012J20+ CATTTTTTCCTCTCTGTGACGATGCTTCGCTCTGATCTCTTTCCTTGGACGCCTTCCACT
                      ____________________________________________________________
consensus CATTTTTTCCTCTCTGTGACGATGCTTCGCTCTGATCTCTTTCCTTGGACGCCTTCCACT
 
. : . : . : . : . : . :
JMFF012J20+ CCTAAGATCCCATCGCCTCTCATTGCTTAACCTTTCTCCGGAATTCAATGTCTCGCCGGA
                      ____________________________________________________________
consensus CCTAAGATCCCATCGCCTCTCATTGCTTAACCTTTCTCCGGAATTCAATGTCTCGCCGGA
 
. : . : . : . : . : . :
JMFF012J20+ TCTCCTAGTACAAACATGCTCCGACGTGTAAAAACCTTTTCTTGAGTATAAATCACTTTG
                      ____________________________________________________________
consensus TCTCCTAGTACAAACATGCTCCGACGTGTAAAAACCTTTTCTTGAGTATAAATCACTTTG
 
. : . : . : . : . : . :
JMFF012J20+ ACCGCCTCCGGTTTTCGGGTCGAGCTTCCTCAAATGCTCAATTACAATTTTGTTTTCATC
                      ____________________________________________________________
consensus ACCGCCTCCGGTTTTCGGGTCGAGCTTCCTCAAATGCTCAATTACAATTTTGTTTTCATC