Previous Contig 000662:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009I12Sequence558000662 (21)gb:AF251843_17810077e-69Helianthus annuus delta-12 oleate desaturase (FAD2-2) mRNA, complete cds.746000662 (21)gb:AY178447_1587203e-105Punica granatum delta-12 oleate desaturase mRNA, complete cds.
JMFF012J01Sequence511000662 (21)gb:AF251843_17810071e-58Helianthus annuus delta-12 oleate desaturase (FAD2-2) mRNA, complete cds.687000662 (21)gb:AY525163_16115702e-98Cucurbita pepo omega-6 fatty acid desaturase (FAD2) mRNA, complete cds.
JMFF019P14Sequence548000662 (21)gb:AF251843_17810072e-67Helianthus annuus delta-12 oleate desaturase (FAD2-2) mRNA, complete cds.746000662 (21)gb:AY178447_1587203e-101Punica granatum delta-12 oleate desaturase mRNA, complete cds.
JMFF030H09Sequence277000662 (21)gb:AY083163_15692261e-18Olea europaea subsp. europaea fatty acid desaturase 2 (fad2) mRNA, complete cds.694000662 (21)gb:AY178447_1587203e-105Punica granatum delta-12 oleate desaturase mRNA, complete cds.
JMFN018D23Sequence639000662 (21)gb:AF192486_1775517e-105Sesamum indicum omega-6 fatty acid desaturase (FAD2) mRNA, complete cds.
JMFN037D01Sequence637000662 (21)gb:AY178447_1587203e-104Punica granatum delta-12 oleate desaturase mRNA, complete cds.
JMFS071G01Sequence609000662 (21)gb:AY178447_1587203e-103Punica granatum delta-12 oleate desaturase mRNA, complete cds.
JMFS077B04Sequence626000662 (21)gb:AY178447_1587203e-107Punica granatum delta-12 oleate desaturase mRNA, complete cds.
JMSF002D19Sequence337000662 (21)pir|T15042|T150425e-26omega-6 fatty acid desaturase (EC 1.14.99.-) - parsley>gb:PCU86072_1699523 Petro734000662 (21)gb:AY178447_15872033e-99Punica granatum delta-12 oleate desaturase mRNA, complete cds.
JMSF034B10Sequence337000662 (21)gb:AF525534_18083125e-46Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.
JMSF041O09Sequence524000662 (21)gb:AF251843_17810073e-61Helianthus annuus delta-12 oleate desaturase (FAD2-2) mRNA, complete cds.791000662 (21)gb:AY178447_1587203e-115Punica granatum delta-12 oleate desaturase mRNA, complete cds.
JMSF051J23Sequence714000662 (21)gb:AF074324_17660992e-89Borago officinalis delta-12 fatty acid desaturase mRNA, complete cds.748000662 (21)gb:AY178447_1587203e-111Punica granatum delta-12 oleate desaturase mRNA, complete cds.
JMSF052N02Sequence639000662 (21)gb:AF074324_17660991e-78Borago officinalis delta-12 fatty acid desaturase mRNA, complete cds.878000662 (21)gb:AY178447_1587203e-132Punica granatum delta-12 oleate desaturase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009I12- GTTTATTCAACCG
                      ____________________________________________________________
consensus GTTTATTCAACCG
 
. : . : . : . : . : . :
rJMSF002D19- GCAACCAATGGTTTCTCACACATTAAACAAAACGGCATACATTTAGAACAACGATCAAAA
rJMFF012J01- GCAACCAAT-GTTTCTCACACATTAAACAAAACGGCATACATTTAGAACAACGATCAAAA
rJMFF009I12- GCAACCAAT-GTTTCTCACACATTAAACAAAACGGCATACATTTAGAACAACGATCAAAA
rJMSF041O09- GGCATACATTTAGAACAACGATCAAAA
rJMFF030H09- TTTAGAACAACGATCAAAA
rJMSF051J23- TCTCACACATTAAACAAAACGGCATACATTTAGAACAACGATCAAAA
rJMSF052N02- ACCAAT-GTTTCTCACACATTAAACAAAACGGCATACATTTAGAACAACGATCAAAA
                      ____________________________________________________________
consensus GCAACCAAT-GTTTCTCACACATTAAACAAAACGGCATACATTTAGAACAACGATCAAAA
 
. : . : . : . : . : . :
rJMSF002D19- CATTGCAACAA-GAAAACAAGAAAATCGTACGTTTTTTTCCTAACAATTCAAAGTTTATT
rJMFF012J01- CATTGCAACAA-GAAAACAAGAAAATCGTACGTTTTTTTCCTAACAATTCAAAGTTTATT
rJMFF009I12- CATTGCAACAA-GAAAACAAGAAAATCGTACGTTTTTTTCCTAACAATTCAAAGTTTATT
rJMSF041O09- CATTGCAACAAGGAAAACAAGAAAATCGTACGTTTTTTTCCTAACAATTCAAAGTTTATT
JMFN037D01+ TTTTTTCCTAACAATTCAAAGTTTATT
rJMFF030H09- CATTGCAACAA-GAAAACAAGAAAATCGTACGTTTTTTTCCTAACAATTCAAAGTTTATT
rJMFF019P14- AATTCAAAGTTTATT
rJMSF051J23- CATTGCAACAA-GAAAACAAGAAAATCGTACGTTTTTTTCCTAACAATTCAAAGTTTATT
rJMSF052N02- CATTGCAACAA-GAAAACAAGAAAATCGTACGTTTTTTTCCTAACAATTCAAAGTTTATT
                      ____________________________________________________________
consensus CATTGCAACAA-GAAAACAAGAAAATCGTACGTTTTTTTCCTAACAATTCAAAGTTTATT
 
. : . : . : . : . : . :
rJMSF002D19- CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
rJMFF012J01- CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
rJMFF009I12- CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
rJMSF041O09- CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
JMFN037D01+ CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
rJMFF030H09- CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
rJMFF019P14- CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
rJMSF051J23- CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
rJMSF052N02- CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
                      ____________________________________________________________
consensus CTTGTACCAGAAGACACCCTTGTTCTTGTCACCTTCATCTGGCTCCACATAAATACACTC
 
. : . : . : . : . : . :
rJMSF002D19- CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
rJMFF012J01- CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
rJMFF009I12- CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
rJMSF041O09- CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
JMFN037D01+ CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
rJMFF030H09- CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
rJMFF019P14- CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
rJMSF051J23- CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
rJMSF052N02- CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
                      ____________________________________________________________
consensus CTTGACTTCCCTAAACATTGCTGCAAAGATTGGCGTGCCATCGAACTGATAGTACTCGCC
 
. : . : . : . : . : . :
rJMSF002D19- CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
rJMFF012J01- CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
rJMFF009I12- CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
rJMSF041O09- CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
JMFN037D01+ CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
rJMFF030H09- CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
rJMFF019P14- CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
rJMSF051J23- CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
rJMSF052N02- CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
                      ____________________________________________________________
consensus CAGAACTGGCTTGATAGCCTTGGTGGCCTCCATTGCATGATAGTGGGGCATGGTGGAGAA
 
. : . : . : . : . : . :
rJMSF002D19- CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
rJMFF012J01- CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
rJMFF009I12- CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
rJMSF041O09- CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
JMFN037D01+ CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
rJMFF030H09- CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
rJMFF019P14- CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
rJMSF051J23- CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
rJMSF052N02- CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
JMFN018D23+ ACACCCTGTTGAGGATCCCGTA
                      ____________________________________________________________
consensus CAGATGATGCGCTACGTGAGTATCTGTGATGTTGTGGAACACCTTGTTGAGGATCCCGTA
 
. : . : . : . : . : . :
rJMSF002D19- GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
rJMFF012J01- GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
rJMFF009I12- GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
rJMSF041O09- GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
JMFN037D01+ GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
rJMFF030H09- GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
rJMFF019P14- GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
rJMSF051J23- GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
rJMSF052N02- GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
JMFN018D23+ GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
JMFS077B04+ CGAGGAATTGTAGTG
                      ____________________________________________________________
consensus GTCTCTGTCGACTGTGGAGAGTGCGCCCCTTAGCCAATCCCACTCCGAGGAATTGTAGTG
 
. : . : . : . : . : . :
rJMSF002D19- TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
rJMFF012J01- TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
rJMFF009I12- TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
rJMSF041O09- TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
JMFN037D01+ TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
rJMFF030H09- TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
rJMFF019P14- TGGCAATGCGGGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
rJMSF051J23- TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
rJMSF052N02- TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
rJMSF034B10- GGGGTGGGTGTGCTGCAAGTACGTGATCAAAACAAGGAACCCGTTCACGA
JMFN018D23+ TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
JMFS077B04+ TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
JMFS071G01+ GCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
                      ____________________________________________________________
consensus TGGCAATGC-GGGGTGGGTGTGCTGCAGGTACGTGATCAAAACAAGGAACCCGTTCACGA
 
. : . : . : . : . : . :
rJMSF002D19- TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
rJMFF012J01- TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
rJMFF009I12- TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
rJMSF041O09- TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
JMFN037D01+ TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
rJMFF030H09- TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
rJMFF019P14- TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
rJMSF051J23- TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
rJMSF052N02- TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
rJMSF034B10- TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
JMFN018D23+ TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
JMFS077B04+ TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
JMFS071G01+ TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
                      ____________________________________________________________
consensus TGAGTAATGGGACACCGTAGACACAGACAACCCACGCGAGCCCCTTGGCTGCTGCTAGCT
 
. : . : . : . : . : . :
rJMSF002D19- TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
rJMFF012J01- TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
rJMFF009I12- TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
rJMSF041O09- TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
JMFN037D01+ TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
rJMFF030H09- TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
rJMFF019P14- TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
rJMSF051J23- TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
rJMSF052N02- TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
rJMSF034B10- TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
JMFN018D23+ TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
JMFS077B04+ TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
JMFS071G01+ TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
                      ____________________________________________________________
consensus TATACAGCACGTAGGTTGCAGCGAAGATCCCGGTATCCGAGATGAAGATCTGGATGCGCT
 
. : . : . : . : . : . :
rJMSF002D19- CGCGGTCTGAGTATATA-GGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
rJMFF012J01- CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
rJMFF009I12- CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
rJMSF041O09- CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
JMFN037D01+ CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
rJMFF030H09- CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
rJMFF019P14- CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
rJMSF051J23- CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
rJMSF052N02- CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
rJMSF034B10- CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
JMFN018D23+ CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
JMFS077B04+ CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
JMFS071G01+ CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
                      ____________________________________________________________
consensus CGCGGTCTGAGTATATAGGGCCATAGGGATCAAAGTGGCAGGCGAAGCGGGGGTATGGTC
 
. : . : . : . : . : . :
rJMSF002D19- TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
rJMFF012J01- TGCCAGAGACATTGAACATCAAGTATA
rJMFF009I12- TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGACTG
rJMSF041O09- TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
JMFN037D01+ TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
rJMFF030H09- TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
rJMFF019P14- TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
rJMSF051J23- TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
rJMSF052N02- TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
rJMSF034B10- TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
JMFN018D23+ TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
JMFS077B04+ TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
JMFS071G01+ TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
JMSF051J23+ CCAGAGACATTGAACATCAAGTATAGAGGCCATCNTAGGGTAAGCTGGATAAGGAGTG
                      ____________________________________________________________
consensus TGCCAGAGACATTGAACATCAAGTATAGAGGCCATCCTAGGGTAAGCTGGATAAGGAGTG
 
. : . : . : . : . : . :
rJMSF002D19- TG-AATGCTCTGCCC
rJMFF009I12- TG-AATGCTCTGCCCGG
rJMSF041O09- TG-AATGCTCTGCCCGGTGGGTTATTAAGATATTTGGCATGCCAGCCGAGATCAGACTTC
JMFN037D01+ TGAA
rJMFF030H09- TG-AATGCTCTGCCC
rJMFF019P14- TG-AATGCTCTGCCCGG
rJMSF051J23- TG-AATGCTCTGCCCGGTGGGTTATTAAGATATTTGGCATGCCA
rJMSF052N02- TG-AATGCTCTGCCCGGTGGGTTATTAAGATATTTGGCATGCCAGCCGAGATCAGACTTC
rJMSF034B10- TGAAATGCTCTGCCCGGNGGGTTATTAANATATTTGGCATGCCAGCC
JMFN018D23+ TG-AATGCTCTGCCCGGTGGGTTATTAAGATATTTGGCATGCCAGCCGAGATCAGACTTC
JMFS077B04+ TG-AATGCTCTGCCCGGTGGGTTATTAAGATATTTGGCATGCCAGCCGAGATCAGACTTC
JMFS071G01+ TG-AATGCTCTGCCCGGTGGGTTATTAAGATATTTGGCATGCCAGCCGAGATCAGACTTC
JMSF052N02+ TGCCAGCCGAGATCAGACTTC
JMSF051J23+ TG-AATGCTCTGCCCGGTGGGTTATTAAGATATTTGGCATGCCAGCCGAGATCAGACTTC
                      ____________________________________________________________
consensus TG-AATGCTCTGCCCGGTGGGTTATTAAGATATTTGGCATGCCAGCCGAGATCAGACTTC
 
. : . : . : . : . : . :
rJMSF041O09- TGCTTGGGGGACAANGACCTCATCCCGCTCAAGGGAACCAGTGTTG
rJMSF052N02- TGCTT-GGGGACAAAGACCTCATCCCGCTCAAGGGAACCAGTGTTGGAATGGTGGCGGCG
JMFN018D23+ TGCTT-GGGGACAAAGACCTCATCCCGCTCAAGGGAACCAGTGTTGGAATGGTGGCGGCG
JMFS077B04+ TGCTT-GGGGACAAAGACCTCATCCCGCTCAAGGGAACCAGTGTTGGAATGGTGGCGGCG
JMFS071G01+ TGCTT-GGGGACAAAGACCTCATCCCGCTCAAGGGAACCAGTGTTGGAATGGTGGCGGCG
JMFF009I12+ TGGAATGGTGGCGGCG
JMSF052N02+ TGCTT-GGGGACAAAGACNTCATCCCGCTCAAGGGAACCAGTGTTGGAATGGTGGCGGCG
JMSF051J23+ TGCTT-GGGGACAAAGACCTCATCCCGCTCAAGGGAACCAGTGTTGGAATGGTGGCGGCG
JMFF019P14+ GTGGCGGCG
                      ____________________________________________________________
consensus TGCTT-GGGGACAAAGACCTCATCCCGCTCAAGGGAACCAGTGTTGGAATGGTGGCGGCG
 
. : . : . : . : . : . :
rJMSF052N02- ATGGCTATATTTCCAGGAGAAGAATGGAACAAGGAGGGCGGA
JMFN018D23+ ATGGCTATATTTCCAGGAGAAGAATGGAACAAGGAGGGCGGAGTGCAGGATAAGGCCGAC
JMFS077B04+ ATGGCTATATTTCCAGGAGAAGAATGGAACAAGGAGGGCGGAGTGCAGGATAAGGCCGAC
JMFS071G01+ ATGGCTATATTTCCAGGAGAAGAATGGAACAAGGAGGGCGGAGTGCAGGATAAGGCCGAC
JMSF041O09+ TTTCCAGGAGAAGAATGGAACAAGGAGGGCGGAGTGCAGGATAAGGCNGAC
JMFF009I12+ ATGGCTATATTTCCAGGAGAAGAATGGAACAAGGAGGGCGGAGTGCAGGATAAGGCCGAC
JMSF052N02+ ATGGCTATATTTCCAGGAGAAGAATGGAACAAGGAGGGCGGAGTGCAGGATAAGGCCGAC
JMSF051J23+ ATGGCTATATTTCCAGGAGAAGAATGGAACAAGGAGGGCGGAGTGCAGGATAAGGCCGAC
JMFF019P14+ ATGGCTATATTTCCAGGAGAAGAATGGAACAAGGAGGGCGGAGTGCAGGATAAGGCCGAC
JMFF012J01+ CAAGGAGGGCGGAGTGCAGGATAAGGCCGAC
                      ____________________________________________________________
consensus ATGGCTATATTTCCAGGAGAAGAATGGAACAAGGAGGGCGGAGTGCAGGATAAGGCCGAC
 
. : . : . : . : . : . :
JMFN018D23+ AGTGTCATCCAGCCACTGGTAGTCACTGAAGGCGTGGTGGCCACATTCATGTGCAA
JMFS077B04+ AGTGTCATCCAGCCACTGGTAGTCACTGAAGGCGTGGTGGCCACATTCATGTGCAATGAC
JMFS071G01+ AGTGTCATCCAGCCACTGGTAGTCACTGAAGGCGTGGTGGCCACATTCATGTGCAATGAC
JMSF041O09+ AGTGTCATCCAGCCANTGGTAGTCANTGAAGGCGTGGTGGCCACATTCATGTGCAATGAC
JMFF009I12+ AGTGTCATCCAGCCACTGGTAGTCACTGAAGGCGTGGTGGCCACATTCATGTGCAATGAC
JMSF052N02+ AGTGTCATCCAGCCACTGGTAGTCACTGAAGGCGTGGTGGCCACATTCATGTGCAATGAC
JMSF051J23+ AGTGTCATCCAGCCACTGGTAGTCACTGAAGGCGTGGTGGCCACATTCATGTGCAATGAC
JMFF019P14+ AGTGTCATCCAGCCACTGGTAGTCACTGAAGGCGTGGTGGCCACATTCATGTGCAATGAC
JMFF012J01+ AGTGTCATCCAGCCACTGGTAGTCACTGAAGGCGTGGTGGCCACATTCATGTGCAATGAC
                      ____________________________________________________________
consensus AGTGTCATCCAGCCACTGGTAGTCACTGAAGGCGTGGTGGCCACATTCATGTGCAATGAC
 
. : . : . : . : . : . :
JMFS077B04+ CCAAACTCCAGTCAGCACACAGCCCTGGAAGGTCCAGTAAAGCGGCCATGCCAGGTAGGA
JMFS071G01+ CCAAACTCCAGTCAGCACACAGCCCTGGAAGGTCCAGTAAAGCGGCCATGCCAGGTAGGA
JMSF041O09+ CCAAACTCCAGTCAGCACACAGCCCTGGCAGATCCAGTAAAGCGGCCATGCCAGGTAGGA
JMFF009I12+ CCAAACTCCAGTCAGCACACAGCCCTGGCAGATCCAGTAAAGCGGCCATGCCAGGTAGGA
JMSF052N02+ CCAAACTCCAGTCAGCACACAGCCCTGGCAGATCCAGTAAAGCGGCCATGCCAGGTAGGA
JMSF051J23+ CCAAACTCCAGTCAGCACACAGCCCTGGCAGATCCAGTAAAG-GGCCATGCCAGGTAGGA
JMFF019P14+ CCAAACTCCAGTCAGCACACAGCCCTGGCAGATCCAGTAAAGCGGCCATGCCAGGTAGGA
JMFF012J01+ CCAAACTCCAGTCAGCACACAGCCCTGGCAGATCCAGTAAAGCGGCCATGCCAGGTAGGA
                      ____________________________________________________________
consensus CCAAACTCCAGTCAGCACACAGCCCTGGCAGATCCAGTAAAGCGGCCATGCCAGGTAGGA
 
. : . : . : . : . : . :
JMFS077B04+ GAGAGGGTGTGGGA
JMFS071G01+ GAGAGGGTGTGGGA
JMSF041O09+ GAGAGGGTGTGGGAGGAGATGGAAGTAGTTGGTAGCAACATAGTAGAGGGAAGAGGCAAT
JMFF009I12+ GAGAGGGTGTGGGAGGAGATGGAAGTAGTTGGTAGCAACATAGTAGAGGGAAGAGGCAAT
JMSF052N02+ GAGAGGGTGTGGGAGGAGATGGAAGTAGTTGGTAGCAACATAGTAGAGGGAAGAGGCAAT
JMSF051J23+ GAGAGGGTGTGGGAGGAGATGGAAGTAGTTGGTAGCAACATAGTAGAGGGAAGAGGCAAT
JMFF019P14+ GAGAGGGTGTGGGAGGAGATGGAAGTAGTTGGTAGCAACATAGTAGAGGGAAGAGGCAAT
JMSF002D19+ AGTAGTTGGTAGCAACATAGTAGAGGGAAGAGGCAAT
JMFF012J01+ GAGAGGGTGTGGGAGGAGATGGAAGTAGTTGGTAGCAACATAGTAGAGGGAAGAGGCAAT
                      ____________________________________________________________
consensus GAGAGGGTGTGGGAGGAGATGGAAGTAGTTGGTAGCAACATAGTAGAGGGAAGAGGCAAT
 
. : . : . : . : . : . :
JMSF041O09+ TATGAGGTCGTAAACAACATAAGAGAATGAGCGGAGGACAGACCGTTGGAAACAATGGGG
JMFF030H09+ AAACAACATAAGAGAATGAGCGGAGGACAGACCGTNGGAAACAATGGGG
JMFF009I12+ TATGAGGTCGTAAACAACATAAGAGAATGAGCGGAGGACAGACCGTTGGAAACAATGGGG
JMSF052N02+ TATGAGGTCGTAAACAACATAAGAGAATGAGCGGAGGACAGACCGTTGGAAACAATGGGG
JMSF051J23+ TATGAGGTCGTAAACAACATAAGAGAATGAGCGGAGGACAGACCGTTGGAAACAATGGGG
JMFF019P14+ TATGAGGTCGTAAACAACATAAGAGAATGAGCGGAGGACAGACCGTTGGAAACAATGGGG
JMSF002D19+ TATGAGGTCGTAAACAACATAAGAGAATGAGCGGAGGACAGACCGTTGGAAACAATGGGG
JMFF012J01+ TATGAGGTCGTAAACAACATAAGAGAATGAGCGGAGGACAGACCGTTGGAAACAATGGGG
                      ____________________________________________________________
consensus TATGAGGTCGTAAACAACATAAGAGAATGAGCGGAGGACAGACCGTTGGAAACAATGGGG
 
. : . : . : . : . : . :
JMSF041O09+ TGGAATTGCTTTCTTGATCTCACCTAAAGTAAAAGGCGGTTTAGCATATGGAACACGCTG
JMFF030H09+ TGGAATTGCTTTCTTGATCTCACCTAAAGTAAAAGGCGGTTTAGCATATGGAACACGCTG
JMFF009I12+ TGGAATTGCTTTCTTGATCTCACCTAAAGTAAAAGGCGGTTTAGCATATGGAACACGCTG
JMSF052N02+ TGGAATTGCTTTCTTGATCTCACCTAAAGTAAAAGGCGGTTTAGCATATGGAACACGCT
JMSF051J23+ TGGAATTGCTTTCTTGATCTCACCTAAAGTAAAAGGCGGTTTAGCATATGGAACACGCTG
JMFF019P14+ TGGAATTGCTTTCTTGATCTCACCTAAAGTAAAAGGCGGTTTAGCATATGGAACACGCTG
JMSF002D19+ TGGAATTGCTTTCTTGATCTCACCTAAAGTAAAAGGCGGTTTAGCATATGGAACACGCTG
JMFF012J01+ TGGAATTGCTTTCTTGATCTCACCTAAAGTAAAAGGCGGTTTAGCATATGGAACACGCTG
                      ____________________________________________________________
consensus TGGAATTGCTTTCTTGATCTCACCTAAAGTAAAAGGCGGTTTAGCATATGGAACACGCTG
 
. : . : . : . : . : . :
JMSF041O09+ AAGATCTTGTTTAGACATCTTGCCCTCAGCGGGTACAGCCATTCTGCCTCCAGCACCCAT
JMFF030H09+ AAGATCTTGTTTAGACATCTTGCCCTCAGCGGGTACAGCCATTCTGCCTCCAGCACCCAT
JMFF009I12+ AAGATCTTGTTTAGACATCTTGCCCTCAGCGGGTACAGCCATTCTGCCTCCAGCACCCAT
JMSF051J23+ AAGATCTTGTTTAGACATCTTGCCCTCAGCGGGTACAGCCATTCTGCCTCCAGCACCCAT
JMFF019P14+ AAGATCTTGTTTAGACATCTTGCCCTCAGCGGGTACAGCCATTCTGCCTCCAGCACCCAT
JMSF002D19+ AAGATCTTGTTTAGACATCTTGCCCTCAGCGGGTACAGCCATTCTGCCTCCAGCACCCAT
JMFF012J01+ AAGATCTTGTTTAGACATCTTGCCCTCAGCGGGTACAGCCATTCTGCCTCCAGCACCCAT
                      ____________________________________________________________
consensus AAGATCTTGTTTAGACATCTTGCCCTCAGCGGGTACAGCCATTCTGCCTCCAGCACCCAT
 
. : . : . : . : . : . :
JMSF041O09+ TTTTCCTCAAGAGATATTTCCGCTTCTCTCTACCTCACTGAGCTCCTATCTCCACCCACT
JMFF030H09+ TTTTCCTCAAGAGATATTTCCGCTTCTCTCTACCTCACTGAGCTCCTATCTCCACCCACT
JMFF009I12+ TTTTCCTCAAGAGATATTTCCGCTTCTCTCTACCTCACTGAGCTCCTATCTCCACCCACT
JMSF051J23+ TTTTCCTCAAGAGATATTTCCGCTTCTCTCTACCTCACTGAGCTCCTATCTCCACCCACT
JMFF019P14+ TTTTCCTCAAGAGATATTTCCGCTTCTCTCTACCTCACTGAGCTCCTATCTCCACCCACT
JMSF002D19+ TTTTCCTCAAGAGATATTTCCGCTTCTCTCTACCTCACTGAGCTCCTATCTCCACCCACT
JMFF012J01+ TTTTCCTCAAGAGATATTTCCGCTTCTCTCTACCTCACTGAGCTCCTATCTCCACCCACT
                      ____________________________________________________________
consensus TTTTCCTCAAGAGATATTTCCGCTTCTCTCTACCTCACTGAGCTCCTATCTCCACCCACT
 
. : . : . : . : . : . :
JMSF041O09+ TCTCTCTCTCTCTCTCTACCTTCCGAGAAGAGTGGCCGTAGAATCGCCGTGTC
JMFF030H09+ TCTCTCTCTCTCTCTCTACCTTCCGAGAAGAGTGGCCGTAGAATCGCC
JMFF009I12+ TCTCTCTCTCTCTCTCTACCTTCCGAGAAGAGTGGCCGTAGAATCGCCGTGTCTTC
JMSF051J23+ TCTCTCTCTCTCTCTCTACCTTCCGAGAAGAGTGGCCGTAGAATCGCCGTGTCTTCTCC
JMFF019P14+ TCTCTCTCTCTCTCTCTACCTTCCGAGAAGAGTGGCCGTAGAATCGCCGTGTCTTCTCC
JMSF002D19+ TCTCTCTCTCTCTCTCTACCTTCCGAGAAGAGTGGCCGTAGAATCGCCGTGTCTTCTCC
JMFF012J01+ TCTCTCTCTCTCTCTCTACCTTCCGAGAAGAGTGGCCGTAGAATCGCCGTGTCTTCTCCA
                      ____________________________________________________________
consensus TCTCTCTCTCTCTCTCTACCTTCCGAGAAGAGTGGCCGTAGAATCGCCGTGTCTTCTCCA