Previous Contig 000660:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012I08Sequence510000660 (4)gb:AP005393_18510010.034Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P048
JMFF031H20Sequence575000660 (4)gb:AY085489_15705585e-06Arabidopsis thaliana clone 15392 mRNA, complete sequence.701021360gb:AB020746_15146276e-11Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MOB24.
JMFF033A01Sequence591000660 (4)gb:AY085489_15705582e-08Arabidopsis thaliana clone 15392 mRNA, complete sequence.729009746 (3)gb:AP005393_18510014e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P048
JMSF051N22Sequence621000660 (4)gb:AY085489_15705582e-09Arabidopsis thaliana clone 15392 mRNA, complete sequence.683009746 (3)gb:AP005393_18510011e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051N22+ GGAGATGAAACCGACGAGGACT
                      ____________________________________________________________
consensus GGAGATGAAACCGACGAGGACT
 
. : . : . : . : . : . :
JMFF033A01+ CGAAATCAATCCAACAACCAGCGGGGACGTCGAATTCCCGCCGAGAATCTCAT
JMSF051N22+ TCATCAGCGAAATCAATCCAACAACCAGCGGGGACGTCGAATTCCCGCCGAGAATCTCAT
JMFF031H20+ CAGCGGGGACGTCGAATTCCCGCCGAGAATCTCAT
                      ____________________________________________________________
consensus TCATCAGCGAAATCAATCCAACAACCAGCGGGGACGTCGAATTCCCGCCGAGAATCTCAT
 
. : . : . : . : . : . :
JMFF033A01+ CCGCGAGCGTCGAGTACATCGACGCCCTAGCCGGCGACGAGTAAGGGCCAGCGGGCTTGG
JMSF051N22+ CCGCGAGCGTCGAGTACATCGACGCCCTAGCCGGCGACGAGTAAGGGCCAGCGGGCTTGG
JMFF031H20+ CCGCGAGCGTCGAGTACATCGACGCCCTAGCCGGCGACGAGTAAGGGCCAGCGGGCTTGG
JMFF012I08+ CCGGCGACGAGTAAGGGCCAGCGGGCTTGG
                      ____________________________________________________________
consensus CCGCGAGCGTCGAGTACATCGACGCCCTAGCCGGCGACGAGTAAGGGCCAGCGGGCTTGG
 
. : . : . : . : . : . :
JMFF033A01+ GCCGTCGGAAATCGGAGGAGGGCTTGGAATCGGGTTTCTGGAAGAAGCGGGAACGGGCGG
JMSF051N22+ GCCGTCGGAAATCGGAGGAGGGCTTGGAATCGGGTTTCTGGAAGAAGCGGGAACGGGCGG
JMFF031H20+ GCCGTCGGAAATCGGAGGAGGGCTTGGAATCGGGTTTCTGGAAGAAGCGGGAACGGGCGG
JMFF012I08+ GCCGTCGGAAATCGGAGGAGGGCTTGGAATCGGGTTTCTGGAAGAAGCGGGAACGGGCGG
                      ____________________________________________________________
consensus GCCGTCGGAAATCGGAGGAGGGCTTGGAATCGGGTTTCTGGAAGAAGCGGGAACGGGCGG
 
. : . : . : . : . : . :
JMFF033A01+ AGCAGCACTCATGGAAGAATCGGCAGCTGCCCACCTTGGAGGAAGCCGAAGACGCAATGT
JMSF051N22+ AGCAGCACTCATGGAAGAATCGGCAGCTGCCCACCTTGGAGGAAGCCGAAGACGCAATGT
JMFF031H20+ AGCAGCACTCATGGAAGAATCGGCAGCTGCCCACCTTGGAGGAAGCCGAAGACGCAATGT
JMFF012I08+ AGCAGCACTCATGGAAGAATCGGCAGCTGCCCACCTTGGAGGAAGCCGAAGACGCAATGT
                      ____________________________________________________________
consensus AGCAGCACTCATGGAAGAATCGGCAGCTGCCCACCTTGGAGGAAGCCGAAGACGCAATGT
 
. : . : . : . : . : . :
JMFF033A01+ TTTGGGCTAAGTAGCCGGAGTAAGTAACGGTGAACCGGATCGCCATAACAACTAATTGTA
JMSF051N22+ TTTGGGCTAAGTAGCCGGAGTAAGTAACGGTGAACCGGATCGCCATAACAACTAATTGTA
JMFF031H20+ TTTGGGCTAAGTAGCCGGAGTAAGTAACGGTGAACCGGATCGCCATAACAACTAATTGTA
JMFF012I08+ TTTGGGCTAAGTAGCCGGAGTAAGTAACGGTGAACCGGATCGCCATAACAACTAATTGTA
                      ____________________________________________________________
consensus TTTGGGCTAAGTAGCCGGAGTAAGTAACGGTGAACCGGATCGCCATAACAACTAATTGTA
 
. : . : . : . : . : . :
JMFF033A01+ AGAAGCTCAGAAACAAATAAAAAATAGTGGGTTCGAAGAGTAACGGTGAGGAGACTACAG
JMSF051N22+ AGAAGCTCAGAAACAAATAAAAAATAGTGGGTTCGAAGAGTAACGGTGAGGAGACTACAG
JMFF031H20+ AGAAGCTCAGAAACAAATAAAAAATAGTGGGTTCGAAGAGTAACGGTGAGGAGACTACAG
JMFF012I08+ AGAAGCTCAGAAACAAATAAAAAATAGTGGGTTCGAAGAGTAACGGTGAGGAGACTACAG
                      ____________________________________________________________
consensus AGAAGCTCAGAAACAAATAAAAAATAGTGGGTTCGAAGAGTAACGGTGAGGAGACTACAG
 
. : . : . : . : . : . :
JMFF033A01+ AGAACCCTAAAAGAAGCCGAGAAATTGCATTGTAATCGACGAAATCAGTGAGCTTGAATC
JMSF051N22+ AGAACCCTAAAAGAAGCCGAGAAATTGCATTGTAATCGACGAAATCAGTGAGCTTGAATC
JMFF031H20+ AGAACCCTAAAAGAAGCCGAGAAATTGCATTGTAATCGACGAAATCAGTGAGCTTGAATC
JMFF012I08+ AGAACCCTAAAAGAAGCCGAGAAATTGCATTGTAATCGACGAAATCAGTGAGCTTGAATC
                      ____________________________________________________________
consensus AGAACCCTAAAAGAAGCCGAGAAATTGCATTGTAATCGACGAAATCAGTGAGCTTGAATC
 
. : . : . : . : . : . :
JMFF033A01+ CGCAACGATGAATTGAAAGGTTAGATCAAACGCCTGGAAAGAAAAACCGGAATCAATTCC
JMSF051N22+ CGCAACGATGAATTGAAAGGTTAGATCAAACGCCTGGAAAGAAAAACCGGAATCAATTCC
JMFF031H20+ CGCAACGATGAATTGAAAGGTTAGATCAAACGCCTGGAAAGAAAAACCGGAATCAATTCC
JMFF012I08+ CGCAACGATGAATTGAAAGGTTAGATCAAACGCCTGGAAAGAAAAACCGGAATCAATTCC
                      ____________________________________________________________
consensus CGCAACGATGAATTGAAAGGTTAGATCAAACGCCTGGAAAGAAAAACCGGAATCAATTCC
 
. : . : . : . : . : . :
JMFF033A01+ ACCAAATCGGACGGGAATCTCAAAGTCAAACTCTCGGAGATGGTGGCGTTGACTAGATAT
JMSF051N22+ ACCAAATCGGACGGGAATCTCAAAGTCAAACTCTCGGAGATGGTGGCGTTGACTAGATAT
JMFF031H20+ ACCAAATCGGACGGGAATCTCAAAGTCAAACTCTCGGAGATGGTGGCGTTGACTAGATAT
JMFF012I08+ ACCAAATCGGACGGGAATCTCAAAGTCAAACTCTCGGAGATGGTGGCGTTGACTAGATAT
                      ____________________________________________________________
consensus ACCAAATCGGACGGGAATCTCAAAGTCAAACTCTCGGAGATGGTGGCGTTGACTAGATAT
 
. : . : . : . : . : . :
JMFF033A01+ CTCCCAGAGGAGAAACTCCGGGAGGGAGAAGCAGAGGTTCAGTTGCAGAGTTGGTGAC
JMSF051N22+ CTCCCAGAGGAGAAACTCCGGGAGGGAGAAGCAGAGGTTCAGTTGCAGAGTTGGTGAC
JMFF031H20+ CTCCCAGAGGAGAAACTCCGGGAGGGAGAAGCAGAGGTTCAGTTGCAGAGTTGGTGAC
JMFF012I08+ CTCCCAGAGGAGAAACTCCGGGAGGGAGAAGCAGAGGTTCAGTTGCAGAGTTGGTGACGC
                      ____________________________________________________________
consensus CTCCCAGAGGAGAAACTCCGGGAGGGAGAAGCAGAGGTTCAGTTGCAGAGTTGGTGACGC