Previous Contig 000656:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004L23Sequence252000656 (32)gb:AF521135_18078734e-13Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete cds.665000656 (32)gb:BOU92652_16339295e-70Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, par
JMFF007G18Sequence433000656 (32)gb:AB126924_15282751e-23Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds.709000656 (32)gb:BOU92652_16339298e-75Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, par
JMFF009I20Sequence527000656 (32)gb:AB126924_15282755e-33Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds.621000656 (32)gb:BOU92652_16339292e-63Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, par
JMFF012H14Sequence420000656 (32)gb:AB126924_15282752e-21Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds.675000656 (32)gb:BOU92652_16339291e-63Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, par
JMFF015H05Sequence471000656 (32)gb:AF521135_18078731e-25Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete cds.679000656 (32)gb:BOU92652_16339295e-70Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, par
JMFF021E11Sequence237000656 (32)gb:PAB133748_16986212e-16Picea abies mRNA for major intrinsic protein.
JMFF024I02Sequence341000656 (32)gb:AB126924_15282752e-14Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds.669000656 (32)gb:AY130971_15812083e-67Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 gene, com
JMFF040P12Sequence319000656 (32)gb:AB048248_15206941e-19Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein, complete cds.707000656 (32)gb:BOU92652_16339298e-75Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, par
JMFF047F15Sequence634000656 (32)gb:AJ605573_18119204e-74Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.552000656 (32)gb:BOU92652_16339292e-36Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, par
JMFF049E13Sequence478000656 (32)gb:AJ605573_18119204e-47Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.344000656 (32)gb:TGTIP1GEN_17250382e-11T.gesneriana mRNA for tonoplast intrinsic protein.
JMFN003N16Sequence614000656 (32)gb:AJ605573_18119201e-73Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.
JMFN005C11Sequence615000656 (32)gb:AJ605573_18119201e-73Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.
JMFN014P07Sequence627000656 (32)gb:AJ605573_18119203e-73Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.
JMFN015N01Sequence615000656 (32)gb:BOU92651_16339281e-48Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-1 mRNA, com
JMFN025P03Sequence354000656 (32)gb:AJ605573_18119207e-28Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.
JMFN035B02Sequence353000656 (32)gb:AJ605573_18119201e-28Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.
JMFN040E11Sequence624000656 (32)gb:AJ605573_18119204e-74Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.
JMFN041P12Sequence603000656 (32)gb:AJ605573_18119202e-84Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.
JMFN043H11Sequence453000656 (32)gb:AF271660_17821603e-46Vitis berlandieri x Vitis rupestris putative aquaporin TIP3 (TIP3) mRNA, complet
JMFS051A02Sequence619000656 (32)gb:AJ605573_18119206e-76Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.
JMFS077E11Sequence414000656 (32)gb:CAR489613_16453481e-23Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip gene).
JMSF047J12Sequence645000656 (32)gb:AJ605573_18119202e-76Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L.721000656 (32)gb:BOU92652_16339297e-77Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, par

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047F15- C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
rJMFF047F15- CTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTTCXXXXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus CTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTTCNNNNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
rJMFF047F15- XXXAAAACAAAATCGAAGATCTTGAATAGAACACATACATAATTACAGAAATGACCCTGG
rJMFF049E13- AACAAAATCGAAGATCTTGAATAGAACACATACATAATTACAGAAATGACCCTGG
JMFS077E11+ AACAAAATCGAAGATCTTGAATAGAACACATACATAATTACAGAAATGACCCTGG
rJMFF012H14- AAAACAAAATCGAAGATCTTGAATAGAACACATACATAATTACAGAAATGACCCTGG
rJMFF040P12- ATCTTGAATAGAACACATACATAATTACAGAAATGACCCTGG
rJMFF015H05- TCTTGAATAGAACACATACATAATTACAGAAATGACCCTGG
rJMFF009I20- TAATTACAGAAATGACCCTGG
rJMFF004L23- CATACATAATTACAGAAATGACCCTGG
rJMSF047J12- AAATCGAAGATCTTGAATAGAACACATACATAATTACAGAAATGACCCTGG
rJMFF024I02- AATTACAGAAATGACCCTGG
rJMFF007G18- ATAGAACACATACATAATTACAGAAATGACCCTGG
                      ____________________________________________________________
consensus NNNAAAACAAAATCGAAGATCTTGAATAGAACACATACATAATTACAGAAATGACCCTGG
 
. : . : . : . : . : . :
rJMFF047F15- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
rJMFF049E13- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
JMFS077E11+ GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
rJMFF012H14- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
rJMFF040P12- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
rJMFF015H05- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
rJMFF009I20- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
rJMFF004L23- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
rJMSF047J12- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
rJMFF024I02- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
rJMFF007G18- GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
                      ____________________________________________________________
consensus GCCCTACACCCACCACCAATCACACAATAGATATCCAAAATTCAAATAAAAACTTGACTC
 
. : . : . : . : . : . :
rJMFF047F15- AAAGATCATTCATACATACATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
rJMFF049E13- AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
JMFS077E11+ AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
rJMFF012H14- AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
rJMFF040P12- AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
rJMFF015H05- AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
rJMFF009I20- AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
rJMFF004L23- AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
rJMSF047J12- AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
rJMFF024I02- AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
rJMFF007G18- AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
                      ____________________________________________________________
consensus AAAGATCATTCATACATAGATAGATAAAAATTTTTTAAAAAAAAATACACCATAATGGGA
 
. : . : . : . : . : . :
rJMFF047F15- ATAGCCGTGGGTGAATAAAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
rJMFF049E13- ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
JMFS077E11+ ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
rJMFF012H14- ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
rJMFF040P12- ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
rJMFF015H05- ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
rJMFF009I20- ATAGACGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
rJMFF004L23- ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
rJMSF047J12- ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
rJMFF024I02- ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
rJMFF007G18- ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
                      ____________________________________________________________
consensus ATAGCCGTGGGTGAATAGAACCATTGCATTTACATTATTACCCCCCACTGCGGTTTAGGG
 
. : . : . : . : . : . :
rJMFF047F15- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
rJMFF049E13- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACCAGGCCAGCAATTCCTCC
JMFS077E11+ CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
rJMFF012H14- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
rJMFF040P12- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
rJMFF015H05- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
rJMFF009I20- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
rJMFF004L23- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
rJMSF047J12- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
rJMFF024I02- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
rJMFF007G18- CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
                      ____________________________________________________________
consensus CAACGCTTCATGGTGTTGAGGGATGAAGATGAGATCATAGACAAGGCCAGCAATTCCTCC
 
. : . : . : . : . : . :
rJMFF047F15- ACCAACAAGCGGCCCAACCCAGTAAATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
rJMFF049E13- ACCAACAAGCGGCCCAACCCAGTAAATCCAGTGGGCGTCCCAGCTCCAG
JMFS077E11+ ACCAACAAGCGGCCCAACCCAGTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
rJMFF012H14- ACCAACAAGCGGCCCAACCCAGTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
rJMFF040P12- ACCAACAAGCGGCCCAACCCANTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
rJMFF015H05- ACCAACAAGCGGCCCAACCCAGTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
rJMFF009I20- ACCAACAAGCGGCCCAACCCAGTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
rJMFF004L23- ACCAACAAGCGGCCCAACCCAGTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
rJMSF047J12- ACCAACAAGCGGCCCAACCCAGTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
rJMFF024I02- ACCAACAAGCGGCCCAACCCAGTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
rJMFF007G18- ACCAACAAGCGGCCCAACCCAGTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
JMFN041P12+ C
                      ____________________________________________________________
consensus ACCAACAAGCGGCCCAACCCAGTAGATCCAGTGGGCGTCCCAGCTCCAGCTCACGACGGC
 
. : . : . : . : . : . :
rJMFF047F15- GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAAAT
JMFS077E11+ GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAA
rJMFF012H14- GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
rJMFF040P12- GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
rJMFF015H05- GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
rJMFF009I20- GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
rJMFF004L23- GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
rJMSF047J12- GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
rJMFF024I02- GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
rJMFF007G18- GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
JMFN041P12+ GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
JMFS051A02+ AT
JMSF047J12+ GAT
                      ____________________________________________________________
consensus GGGGCCGAAAGCCACGGCGGGGTTCATGGAGGCGCCGGTGAAGGCGCCGCCGGCCAAGAT
 
. : . : . : . : . : . :
rJMFF047F15- GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
rJMFF012H14- GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
rJMFF040P12- GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
rJMFF015H05- GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
rJMFF009I20- GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
rJMFF004L23- GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
rJMSF047J12- GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
rJMFF024I02- GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
rJMFF007G18- GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
JMFN041P12+ GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
JMFN040E11+ CGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
JMFS051A02+ GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
JMSF047J12+ GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
JMFN014P07+ TGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
JMFN005C11+ CGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
JMFN003N16+ ACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
JMFF047F15+ GACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
                      ____________________________________________________________
consensus GTTAGCTCCGACGATGAAGCCAATAGCTATAGGTGCGATTGTTCCCAAACTACCCTTCTT
 
. : . : . : . : . : . :
rJMFF047F15- TGGATCCACGG
rJMFF012H14- TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
rJMFF040P12- TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
rJMFF015H05- TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
rJMFF009I20- TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
rJMFF004L23- TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
rJMSF047J12- TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
rJMFF024I02- TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
rJMFF007G18- TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
JMFN041P12+ TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
JMFN040E11+ TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
JMFS051A02+ TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
JMSF047J12+ TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
JMFN014P07+ TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
JMFN005C11+ TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
JMFN003N16+ TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
JMFF047F15+ TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
                      ____________________________________________________________
consensus TGGATCCACGGCCGTTGCGTACACCGTGTACACTAGCCCAAAGGTCATCACTATCTCGAA
 
. : . : . : . : . : . :
rJMFF012H14- CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
rJMFF040P12- CACTAAAGCGTTCANAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
rJMFF015H05- CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
rJMFF009I20- CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
rJMFF004L23- CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
rJMSF047J12- CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
rJMFF024I02- CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
rJMFF007G18- CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
JMFN041P12+ CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
JMFN040E11+ CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
JMFS051A02+ CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
JMSF047J12+ CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
JMFN014P07+ CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
JMFN005C11+ CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
JMFN003N16+ CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
JMFN015N01+ CCAAGCCGCC
JMFN043H11+ CAGATGTCTCCAAGCCGCC
JMFF047F15+ CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
JMFF049E13+ AAGCCGCC
JMFF009I20+ TAAAGNGTTCAGAGCCCCCNNTCNNGATAGTCCAANCCCAGANGTNTCCAANCCGCC
                      ____________________________________________________________
consensus CACTAAAGCGTTCAGAGCCCCCACTCCTGATAGTCCAAACCCAGATGTCTCCAAGCCGCC
 
. : . : . : . : . : . :
rJMFF012H14- AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
rJMFF040P12- AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
rJMFF015H05- AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
rJMFF009I20- AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
rJMFF004L23- AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
rJMSF047J12- AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
rJMFF024I02- AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
rJMFF007G18- AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFN041P12+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFN040E11+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFS051A02+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMSF047J12+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFN014P07+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFN005C11+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFN003N16+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFN015N01+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFN043H11+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAATTGGGCAATCCAGTA
JMFF047F15+ AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFF049E13+ AGTGGAGAACTGANGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
JMFF009I20+ AGTGGAGANCTNGAGGAGCAAGCAAGCGGNGACGGAGCCAAGCAANTGGGCAATCCAGTA
                      ____________________________________________________________
consensus AGTGGAGAACTTGAGGAGCAAGCAAGCGGCGACGGAGCCAAGCAACTGGGCAATCCAGTA
 
. : . : . : . : . : . :
rJMFF012H14- GAGGA
rJMFF040P12- AAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAANGTGACGGC-G
rJMFF015H05- GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGA
rJMFF004L23- GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGA
rJMSF047J12- GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
rJMFF024I02- GAGGATTCCGCGGAGGGAGGGTTATGTTACCGCCGACGAANGCGCCAAA
rJMFF007G18- GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGCGG
JMFN041P12+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMFN040E11+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMFS051A02+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMSF047J12+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMFN014P07+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMFN005C11+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMFN003N16+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMFN015N01+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMFN043H11+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCACGGACGAAGGCGCCAAAGGTGACGGC-G
JMFN025P03+ CCAAAGGTGACGGC-G
JMFN035B02+ CGCCAAAGGTGACGGC-G
JMFF047F15+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMFF049E13+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
JMFF015H05+ GAAGGCGCCAAAGNTGNCGGC-G
JMFF009I20+ GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
                      ____________________________________________________________
consensus GAGGATTCCGCGGA-GGAGGGTTATGTTACCGCCGACGAAGGCGCCAAAGGTGACGGC-G
 
. : . : . : . : . : . :
rJMFF040P12- GGGTTGA
rJMSF047J12- GGGTTGACGTG
rJMFF007G18- GGGTTGACGTGG
JMFN041P12+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFN040E11+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFS051A02+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMSF047J12+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFN014P07+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFN005C11+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFN003N16+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFN015N01+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFN043H11+ GGGTTGACGTGACCGCCGGAGATGTTGGCCCCACCACCAGCCGCCACGAAAAGCCCGAAG
JMFN025P03+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFN035B02+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAGCAGCAGCCGCCACGAAAAGGCCGAAG
JMFF047F15+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFF049E13+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFF015H05+ GGGTNGANGTGNCCGCCGGAGATGTTGGCGCCAACAGCANCCGCCACGAAAAGGCCGAAG
JMFF024I02+ CCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFF007G18+ CCGCNGGAGATGTTGGCGCCAACAGCANCCGCCACGAAAAGGCCGAAG
JMFF040P12+ CAGCANCCGCCNCGAAAAGGCCGAAG
JMFF009I20+ GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
JMFF012H14+ GGAGATGTTGGCGCCAACAGCANCCGCCACGAAAAGGCCGAAG
                      ____________________________________________________________
consensus GGGTTGACGTGGCCGCCGGAGATGTTGGCGCCAACAGCAACCGCCACGAAAAGGCCGAAG
 
. : . : . : . : . : . :
JMFN041P12+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFN040E11+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFS051A02+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMSF047J12+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFN014P07+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFN005C11+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFN003N16+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFN015N01+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFN043H11+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCCTTCCCCGCATCCGGTGAGC
JMFN025P03+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFN035B02+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFF021E11+ CGCCTCCGGTGAGC
JMFF047F15+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFF049E13+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
JMFF015H05+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGG
JMFF004L23+ GGAGGCGGCAACAAGGCCGGAAGGCGTGNTTGGNCCGCCTCCGGTGAGG
JMFF024I02+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGG
JMFF007G18+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGG
JMFF040P12+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGG
JMFF009I20+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGG
JMFF012H14+ GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGG
                      ____________________________________________________________
consensus GCATGAGCTATGGAGGCGGCAACAAGGCCGGAAGGCGTGCTTGGGCCGCCTCCGGTGAGC
 
. : . : . : . : . : . :
JMFN041P12+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFN040E11+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFS051A02+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMSF047J12+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFN014P07+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFN005C11+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFN003N16+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFN015N01+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFN043H11+ -TTGGAGAAGGCCATCCTTGAGCCTTCACCTGAGAACACGAAGATTAGGGTTGAGAAGAA
JMFN025P03+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFN035B02+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF021E11+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF047F15+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF049E13+ -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF015H05+ -CTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF004L23+ CTTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF024I02+ CCTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF007G18+ -CTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF040P12+ -CTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF009I20+ -CTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
JMFF012H14+ -CTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
                      ____________________________________________________________
consensus -TTGGCGAAGGCCATCCCTGAGCCTTCACCTGCGAACACGAAGATTAGGGTTGAGAAGAA
 
. : . : . : . : . : . :
JMFN041P12+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFN040E11+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFS051A02+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMSF047J12+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFN014P07+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFN005C11+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFN003N16+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFN015N01+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFN043H11+ CTCGGCCAACCCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGACCTCCCGATGGC
JMFN025P03+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFN035B02+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF021E11+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF047F15+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF049E13+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF015H05+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF004L23+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF024I02+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF007G18+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF040P12+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF009I20+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
JMFF012H14+ CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
                      ____________________________________________________________
consensus CTCGGCCAACGCCGCCTTCAAGGCGTCGGGGTGAGTCGCCTCCGCCGGCCTCCCGATGGC
 
. : . : . : . : . : . :
JMFN041P12+ TATCT
JMFN040E11+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFS051A02+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMSF047J12+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFN014P07+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFN005C11+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFN003N16+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFN015N01+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFN043H11+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFN025P03+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFN035B02+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF021E11+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF047F15+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF049E13+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF015H05+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF004L23+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF024I02+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF007G18+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF040P12+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF009I20+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
JMFF012H14+ TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
                      ____________________________________________________________
consensus TATCTGTCTAACCGGCATCGTGGTATGAATGAATTGAAGGTGAAGATCAAAGGATGAAAA
 
. : . : . : . : . : . :
JMFN040E11+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTG
JMFS051A02+ TGGATCGGAAGTGAAGGGTT
JMSF047J12+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCCT
JMFN014P07+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCCT
JMFN005C11+ TGGATCGGAAGTGAAGGGTTAATATCAGA
JMFN003N16+ TGGATCGGAAGTGAAGGGTTAATATCA
JMFN015N01+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTA
JMFN043H11+ TGGATCGGAAGTGAAGG
JMFN025P03+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTG
JMFN035B02+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTA
JMFF021E11+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCCT
JMFF047F15+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCCTGG
JMFF049E13+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCACGGTTTCCT
JMFF015H05+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCC
JMFF004L23+ TGGATCGGAAGTGAAGGGTTAAT
JMFF024I02+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCCTGGTTTCCT
JMFF007G18+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGC
JMFF040P12+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCCTGGTTTC
JMFF009I20+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCCTGGTTTCCT
JMFF012H14+ TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCCTGGTTTCCTCCGATGAC
                      ____________________________________________________________
consensus TGGATCGGAAGTGAAGGGTTAATATCAGATCAGTGTACTGGCCTGGTTTCCTCCGATGAC