Previous Contig 000648:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012F02Sequence458000648 (7)728009060 (6)gb:BT004162_16372602e-40Arabidopsis thaliana clone RAFL15-23-F05 (R20566) putative cell division-related
JMFF018B15Sequence367000648 (7)729009060 (6)gb:BT004162_16372601e-21Arabidopsis thaliana clone RAFL15-23-F05 (R20566) putative cell division-related
JMFF018G08Sequence419000648 (7)700009060 (6)gb:BT004162_16372602e-20Arabidopsis thaliana clone RAFL15-23-F05 (R20566) putative cell division-related
JMFF032P20Sequence427000648 (7)687009060 (6)gb:BT004162_16372602e-20Arabidopsis thaliana clone RAFL15-23-F05 (R20566) putative cell division-related
JMFF040O08Sequence455000648 (7)687009060 (6)gb:BT004162_16372603e-43Arabidopsis thaliana clone RAFL15-23-F05 (R20566) putative cell division-related
JMFS057B07Sequence619000648 (7)gb:BT004162_16372605e-11Arabidopsis thaliana clone RAFL15-23-F05 (R20566) putative cell division-related
JMSF018F07Sequence281000648 (7)gb:BT004162_16372605e-04Arabidopsis thaliana clone RAFL15-23-F05 (R20566) putative cell division-related776009060 (6)gb:BT004162_16372601e-29Arabidopsis thaliana clone RAFL15-23-F05 (R20566) putative cell division-related

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018F07+ CCTTCAGTAGCTTTAGGAA
                      ____________________________________________________________
consensus CCTTCAGTAGCTTTAGGAA
 
. : . : . : . : . : . :
JMSF018F07+ GTGTGGCCATTCCAGGATGAGGATGGTATGTGGTGGTCACTATATACTCCCCCTTCTCAC
                      ____________________________________________________________
consensus GTGTGGCCATTCCAGGATGAGGATGGTATGTGGTGGTCACTATATACTCCCCCTTCTCAC
 
. : . : . : . : . : . :
JMSF018F07+ TTCTCCTGTCAGATTTCCCATTATTCTGCAACCTCACTGAACCATTTGCTTGCTTCTCAA
JMFS057B07+ CCTGTCAGATTTCCCATTATTCTGCAACCTCACTGAACCATTTGCTTGCTTCTCAA
                      ____________________________________________________________
consensus TTCTCCTGTCAGATTTCCCATTATTCTGCAACCTCACTGAACCATTTGCTTGCTTCTCAA
 
. : . : . : . : . : . :
JMSF018F07+ TCAACATTGTCTTCACGTCATTACATTCCAATGGATCCTTCGCCCTGTAAGCTTCCTCTC
JMFS057B07+ TCAACATTGTCTTCACGTCATTACATTCCAATGGATCCTTCGCCCTGTAAGCTTCCTCTC
                      ____________________________________________________________
consensus TCAACATTGTCTTCACGTCATTACATTCCAATGGATCCTTCGCCCTGTAAGCTTCCTCTC
 
. : . : . : . : . : . :
JMSF018F07+ TCCTCCCTGTTGCCACCCGCAAATCCACTGAAGCC-TACATGACAGCCTCTCCCTTGGAC
JMFS057B07+ TCCTCCCTGTTGCCACCCGCAAATCCACTGAAGCCTTACATGACAGCCTCTCCCTTGGAC
                      ____________________________________________________________
consensus TCCTCCCTGTTGCCACCCGCAAATCCACTGAAGCCTTACATGACAGCCTCTCCCTTGGAC
 
. : . : . : . : . : . :
JMSF018F07+ TCTCCCTGCTATCTTCAATGGC
JMFS057B07+ TCTCCCTGCTATCTTCAATGGCAGAAGGTTTACAGCAAAGACAACCCATTCTATACCAAA
JMFF032P20+ CCAAA
JMFF018G08+ CCAAA
                      ____________________________________________________________
consensus TCTCCCTGCTATCTTCAATGGCAGAAGGTTTACAGCAAAGACAACCCATTCTATACCAAA
 
. : . : . : . : . : . :
JMFS057B07+ ATTAACTCAACCCCACCACC-TCCCACCTCACAACCTCCACATATTTTCTCC-AAAAAAA
JMFF032P20+ ATTAACTNAACCCCACCACCTTCCCACCTCACAACCTCCACATATTTTCTCC-AAAAAAA
JMFF018G08+ ATTAANTNAACCCCACCACC-TCCCACCTCACAACCTCCACATATTTTCTCC-AAAAAAA
JMFF040O08+ CCTCACAACCTCCACATATTTTNTCCAAAAAAAA
JMFF018B15+ AACCTCCACATATTTTCTCC-AAAAAAA
JMFF012F02+ TCCCACCTCACAACCTCCACATATTTTCTCCAAAAAAAA
                      ____________________________________________________________
consensus ATTAACTCAACCCCACCACC-TCCCACCTCACAACCTCCACATATTTTCTCC-AAAAAAA
 
. : . : . : . : . : . :
JMFS057B07+ GCATCTTTCGCCATTATTGAAACAGTAAAAACAACCAAACTTTACCCCCCAAGATCTACC
JMFF032P20+ GCATCTTTCGCCATTATTGAAACAGTAAAAACAACCAAACTTTACCCCCCAAGATCTACC
JMFF018G08+ GCATCTTTCGCCATTATTGAAACAGTAAAAACAACCAAACTTTACCCCCCAAGATCTACC
JMFF040O08+ GCATCTTTCGCCATTATTGAAACAGTAAAAACAACCAAACTTTACCCCCCAAGATCTACC
JMFF018B15+ GCATCTTTCGCCATTATTGAAACAGTAAAAACAACCAAACTTTACCCCCCAAGATCTACC
JMFF012F02+ GCATCTTTCGCCATTATTGAAACAGTAAAAACAACCAAACTTTACCCCCCAAGATCTACC
                      ____________________________________________________________
consensus GCATCTTTCGCCATTATTGAAACAGTAAAAACAACCAAACTTTACCCCCCAAGATCTACC
 
. : . : . : . : . : . :
JMFS057B07+ CAAACGCATACATCACTCAAACAAC-AAAAAATCAGCTCAGTTCAGAACCCAAGAAACCT
JMFF032P20+ CAAACGCATACATCACTCAAACAACAAAAAAATCAGCTCAGTTCAGAACCCAAGAAACCT
JMFF018G08+ CAAACGCATACATCACTCAAACAACAAAAAAATCAGCTCAGTTCAGAACCCAAGAAACCT
JMFF040O08+ CAAACGCATACATCACTCAAACAAC-AAAAAATCAGCTCAGTTCAGAACCCAAGAAACCT
JMFF018B15+ CAAACGCATACATCACTCAAACAAC-AAAAAATCAGCTCAGTTCAGAACCCAAGAAACCT
JMFF012F02+ CAAACGCATACATCACTCAAACAAC-AAAAAATCAGCTCAGTTCAGAACCCAAGAAACCT
                      ____________________________________________________________
consensus CAAACGCATACATCACTCAAACAAC-AAAAAATCAGCTCAGTTCAGAACCCAAGAAACCT
 
. : . : . : . : . : . :
JMFS057B07+ GCCATTCATTCAGAACCATGCACATCCGTACCAAACAAATACCCACAACTGAATTCAAGA
JMFF032P20+ GCCATTCATTCAGAACCATGCACATCCGTACCAAACAAATACCCACAACTGAATTCAAGA
JMFF018G08+ GCCATTCATTCAGAACCATGCACATCCGTACCAAACAAATACCCACAACTGAATTCAAGA
JMFF040O08+ GCCATTCATTCAGAACCATGCACATCCGTACCAAACAAATACCCACAACTGAATTCAAGA
JMFF018B15+ GCCATTCATTCAGAACCATGCACATCCGTACCAAACAAATACCCACAACTGAATTCAAGA
JMFF012F02+ GCCATTCATTCAGAACCATGCACATCCGTACCAAACAAATACCCACAACTGAATTCAAGA
                      ____________________________________________________________
consensus GCCATTCATTCAGAACCATGCACATCCGTACCAAACAAATACCCACAACTGAATTCAAGA
 
. : . : . : . : . : . :
JMFS057B07+ AATTTGCCAGCAAAAAAGGAATGGGTCACCTTGAATGAGAGGTGAAAGTGAGGGAGTAGT
JMFF032P20+ AATTTGCCAGCAAAAAAGGAATGGGTCACCTTGAATGAGAGGTGAAAGTGAGGGAGTAGT
JMFF018G08+ AATTTGCCAGCAAAAAAGGAATGGGTCACCTTGAATGAGAGGTGAAAGTGAGGGAGTAGT
JMFF040O08+ AATTTGCCAGCAAAAAAGGAATGGGTCACCTTGAATGAGAGGTGAAAGTGAGGGAGTAGT
JMFF018B15+ AATTTGCCAGCAAAAAAGGAATGGGTCACCTTGAATGAGAGGTGAAAGTGAGGGAGTAGT
JMFF012F02+ AATTTGCCAGCAAAAAAGGAATGGGTCACCTTGAATGAGAGGTGAAAGTGAGGGAGTAGT
                      ____________________________________________________________
consensus AATTTGCCAGCAAAAAAGGAATGGGTCACCTTGAATGAGAGGTGAAAGTGAGGGAGTAGT
 
. : . : . : . : . : . :
JMFS057B07+ GGGCTGGTGAAACTAAAAAAGACACAGAAAAAATGGGGGGATCTAGGGCATAGATAGATT
JMFF032P20+ GGGCTGGTGAAACTAAAAAAGACACAGAAAAAATGGGGGGATCTAGGGCATAGATAGATT
JMFF018G08+ GGGCTGGTGAAACTAAAAAAGACACAGAAAAAATGGGGGGATCTAGGGCATAGATAGATT
JMFF040O08+ GGGCTGGTGAAACTAAAAAAGACACAGAAAAAATGGGGGGATCTAGGGCATAGATAGATT
JMFF018B15+ GGGCTGGTGAAACTAAAAAAGACACAGAAAAAATGGGGGGATCTAGGGCATAGATAGATT
JMFF012F02+ GGGCTGGTGAAACTAAAAAAGACACAGAAAAAATGGGGGGATCTAGGGCATAGATAGATT
                      ____________________________________________________________
consensus GGGCTGGTGAAACTAAAAAAGACACAGAAAAAATGGGGGGATCTAGGGCATAGATAGATT
 
. : . : . : . : . : . :
JMFS057B07+ GAGTTTATGAGCAGTGCTAGTGTTCA
JMFF032P20+ GAGTTTATGAGCAGTGCTAGTGTTCACAGAGATGCAAAATTGGGGAAAAA
JMFF018G08+ GAGTTTATGAGCAGTGCTAGTGTTCACAGAGATGCAAAATTGGGGAAAAA
JMFF040O08+ GAGTTTATGAGCAGTGCTAGTGTTCACAGAGATGCAAAATTGGGGAAAAATTGTTCATAC
JMFF018B15+ GAGTTTATGAGCAGTGCTAGTGTTCACAGAGATGCAAAATT
JMFF012F02+ GAGTTTATGAGCAGTGCTAGTGTTCACAGAGATGCAAAATTGGGGAAAAATTGTTCATAC
                      ____________________________________________________________
consensus GAGTTTATGAGCAGTGCTAGTGTTCACAGAGATGCAAAATTGGGGAAAAATTGTTCATAC
 
. : . : . : . : . : . :
JMFF040O08+ AACTAGTTAGGTGTATTTATATATCACTGAACTGCTGGGCAGCTTTCTTTATTATCTGCC
JMFF012F02+ AACTAGTTAGGTGTATTTATATATCACTGAACTGCTGGGCAGCTTTCTTTATTATCTGCC
                      ____________________________________________________________
consensus AACTAGTTAGGTGTATTTATATATCACTGAACTGCTGGGCAGCTTTCTTTATTATCTGCC