Previous Contig 000647:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012E23Sequence544000647 (14)sp|P46942|DB10_NICSY4e-23RNA helicase-like protein DB10.>pir|S42639|S42639 ATP-dependent RNA helicase DB1739003605 (3)sp|P46942|DB10_NICSY3e-37RNA helicase-like protein DB10.>pir|S42639|S42639 ATP-dependent RNA helicase DB1
JMFF020N20Sequence538000647 (14)sp|P46942|DB10_NICSY4e-23RNA helicase-like protein DB10.>pir|S42639|S42639 ATP-dependent RNA helicase DB1708003605 (3)sp|P46942|DB10_NICSY3e-37RNA helicase-like protein DB10.>pir|S42639|S42639 ATP-dependent RNA helicase DB1
JMFF026G09Sequence569000647 (14)pir|T48634|T486341e-24DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis780009443 (2)
JMFF042P08Sequence640000647 (14)pir|T48634|T486348e-28DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis
JMFS013D01Sequence576000647 (14)pir|T48634|T486341e-30DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis
JMFS020D08Sequence642000647 (14)pir|T48634|T486348e-31DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis
JMFS035G02Sequence496000647 (14)gb:ATAC011623_15433143e-12Arabidopsis thaliana chromosome III BAC F24P17 genomic sequence, complete sequen
JMFS045G03Sequence513000647 (14)pir|T48634|T486343e-11DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis
JMFS103B06Sequence560000647 (14)pir|T48634|T486341e-24DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis
JMFS151B03Sequence624000647 (14)pir|T48634|T486341e-28DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis
JMFS158E01Sequence437000647 (14)pir|T48634|T486342e-23DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis
JMFS160E06Sequence545000647 (14)pir|T48634|T486341e-24DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis
JMFS168B02Sequence619000647 (14)pir|T48634|T486349e-31DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis
JMSF039O04Sequence690000647 (14)pir|T48634|T486345e-36DRH1 DEAD box protein-like - Arabidopsis thaliana>gb:ATT15N1_1554534 Arabidopsis864009443 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039O04+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMFS168B02+ TTTCATGCGCCCGGCGATA
JMFS020D08+ TTTCATGCGCCCGGCGATA
JMFS151B03+ ATA
JMFS013D01+ TTTCATGCCGCCGGCGATA
JMSF039O04+ TGAGGTGAGAGGTGGAGGCACATTATCACCGGTTACAGATATTTCATGCCGCCGGCGATA
JMFF042P08+ A
                      ____________________________________________________________
consensus TGAGGTGAGAGGTGGAGGCACATTATCACCGGTTACAGATATTTCATGCGGCCGGCGATA
 
. : . : . : . : . : . :
JMFS168B02+ AGAATCAGGAGATAAGTCACTTCCTACAGTGGATGAACTATCTTTATAAGCAGATGCACC
JMFS020D08+ AGAATCAGGAGATAAGTCACTTCCTACAGTGGATGAACTATCTTTATAAGCAGATGCACC
JMFS151B03+ AGAATCAGGAGATAAGTCACTTCCTACAGTGGATGAACTATCTTTATAAGCAGATGCACC
JMFS013D01+ AGAATCAGGAGATAAGTCACTTCCTACAGTGGATGAACTATCTTTATAAGCAGATGCACC
JMSF039O04+ AGAATCAGGAGATAAGTCACTTCCTACAGTGGATGAACTATCTTTATAAGCAGATGCACC
JMFF042P08+ AGAATCAGGAGATAAGTCACTTCCTACAGTGGATGAACTATCTTTATAAGCAGATGCACC
                      ____________________________________________________________
consensus AGAATCAGGAGATAAGTCACTTCCTACAGTGGATGAACTATCTTTATAAGCAGATGCACC
 
. : . : . : . : . : . :
JMFS168B02+ ATTTCCTACTAATGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
JMFS160E06+ ATTTCCTACTAATGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
JMFS020D08+ ATTTCCTACTAATGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
JMFS151B03+ ATTTCCTACTAATGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
JMFS013D01+ ATTTCCTACTAATGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
JMFS103B06+ CCTACTAATGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
JMSF039O04+ ATTTCCTACTAATGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
JMFF042P08+ ATTTCCTACTAATGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
JMFF026G09+ TGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
                      ____________________________________________________________
consensus ATTTCCTACTAATGGCATGTTTGAAACACCACGAGAGTGGTCGAAGTTGTTTCTTTCACT
 
. : . : . : . : . : . :
JMFS168B02+ CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
JMFS160E06+ CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
JMFS020D08+ CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
JMFS151B03+ CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
JMFS013D01+ CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
JMFS103B06+ CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
JMSF039O04+ CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
JMFF042P08+ CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
JMFS158E01+ GGTGACCTCTACCGTATCTATC
JMFF026G09+ CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
JMFF020N20+ ATCTATC
JMFF012E23+ TACCGTATCTATC
                      ____________________________________________________________
consensus CTGATAGTCCTCCCCACCAGAAGGCTTACTAGAGCCACGGTGACCTCTACCGTATCTATC
 
. : . : . : . : . : . :
JMFS168B02+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFS160E06+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFS020D08+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFS151B03+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFS013D01+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFS103B06+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMSF039O04+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFF042P08+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFS158E01+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFF026G09+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFF020N20+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
JMFS035G02+ GTGTTGCCCATGAGAAGAC-TATGATCAGAAGAACTCGCAAA
JMFF012E23+ AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
                      ____________________________________________________________
consensus AACATCATCATTGTCTCTGTGTTGCCCATGAGAAGACTTTTGAACAGAAGAACTCACAAA
 
. : . : . : . : . : . :
JMFS168B02+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFS160E06+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFS020D08+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFS151B03+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFS013D01+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFS103B06+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMSF039O04+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFF042P08+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFS158E01+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFF026G09+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFF020N20+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
JMFS035G02+ GCCAGCTGATGCATTTATGTATTGGAGCAGAGCCTCCAGGCCTGTCATAGTGAGTAATAT
JMFS045G03+ AGAGCCACCAGTCTTCTCATATTGAGTAATAT
JMFF012E23+ ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
                      ____________________________________________________________
consensus ACCAGCAGATG-ATTTATGTATTGGAGCAGAGCCACCAGGCCTCTCATACTGAGTAATAT
 
. : . : . : . : . : . :
JMFS168B02+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFS160E06+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFS020D08+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFS151B03+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFS013D01+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFS103B06+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMSF039O04+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFF042P08+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFS158E01+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFF026G09+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFF020N20+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
JMFS035G02+ TAGTCTCTGGACTCCAGTAGTAAAAATACCCAGTCTTACCTGCTAACTAAGGCCGTTTCC
JMFS045G03+ TAGNCTTTGTATTCCATTAGTAATGATACCCAGTTTTACCATC-ATC-TATGCC-TTTCC
JMFF012E23+ TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
                      ____________________________________________________________
consensus TAGTCTCTGGATTCCAGTAGTAAAGATACCCAGTCTTACCATC-AAC-AAGGCC-TTTCC
 
. : . : . : . : . : . :
JMFS168B02+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFS160E06+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFS020D08+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFS151B03+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFS013D01+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFS103B06+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMSF039O04+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFF042P08+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFS158E01+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFF026G09+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFF020N20+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
JMFS035G02+ AAGGTTTAGGAAGAGAGGGTTCCTCCGGTGCATATCGTGGATCAGCAGATGCAACTGTTG
JMFS045G03+ ATTGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGTATCAGCAGATGCTATTGCTG
JMFF012E23+ AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
                      ____________________________________________________________
consensus AAGGTTTAGGGAGAGAGGGATCCTCCGGTGCATATCGTGGATCAGCAGATGCAATTGCTG
 
. : . : . : . : . : . :
JMFS168B02+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFS160E06+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFS020D08+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFS151B03+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFS013D01+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFS103B06+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMSF039O04+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFF042P08+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFS158E01+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFF026G09+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFF020N20+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
JMFS035G02+ CCATCTCAAAGCTCACTTTGAGCAATCGGGGAAGCTGGCAAGGTCGCTGCGATCTCAAAA
JMFS045G03+ CCATTTCATAGTTCTCTTTGTACAATCGGGGAAGCTGGTGAGGTCGCTGCGATTTCAAAA
JMFF012E23+ CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
                      ____________________________________________________________
consensus CCATCTCAAAGCTCACTTTGAACAATCGGGGAAGCTGGCGAGGTCGCTGCGATCTCAAAA
 
. : . : . : . : . : . :
JMFS168B02+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFS160E06+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFS020D08+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFS151B03+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFS013D01+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTG-ATAAACGCTACGCGACTCCGATTGT
JMFS103B06+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMSF039O04+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFF042P08+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFS158E01+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFF026G09+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFF020N20+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFS035G02+ ATGAG-TGTTGCGTGTTCGCCAGGTTAGCATGTGTATGGACGGTACGGGGCTCCGATTGT
JMFS045G03+ ATGAGTTGGTGCCT-TTTGTCAGGNTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
JMFF012E23+ ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
                      ____________________________________________________________
consensus ATGAG-TGTTGCCT-TTTGTCAGGTTGAGATGTGTATAAACGCTACGCGACTCCGATTGT
 
. : . : . : . : . : . :
JMFS168B02+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMFS160E06+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMFS020D08+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMFS151B03+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMFS013D01+ -TTCGCTCTT-CCTCTCTCTTTCCCA
JMFS103B06+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMSF039O04+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMFF042P08+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-CCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMFS158E01+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMFF026G09+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMFF020N20+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
JMFS035G02+ CTTCGCTCTTGCCTCTCTCTTTCCCGAGTCTCTCTATTATATGTGTGTTGAAGGGAATGC
JMFS045G03+ -ATCGCAGAT-CCTCTCTCTTT
JMFF012E23+ -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
                      ____________________________________________________________
consensus -TTCGCTCTT-CCTCTCTCTTTCCCAA-TCTCTCTATTATATGTGTGCTGAAGGGAATGA
 
. : . : . : . : . : . :
JMFS168B02+ GAAAGA
JMFS160E06+ GAAAGAGAGAGCCA
JMFS020D08+ GAAAGAGAGAGCCACGCTTCCTGAA
JMFS151B03+ GAAAGAGAGAGCCACGCTTCCTGAAGCTAA
JMFS103B06+ GAAAGAGAGAGCCACGCTTCCTGAAGCTAAGAA
JMSF039O04+ GAAAGAGAGAGCCACGCTTCCTGAAGCTAAGAAGC
JMFF042P08+ GAAAGAGAGAGCCACGCTTCCTGAAGCTAAGAAGCGTAGGGTAATGAA
JMFS158E01+ GAAA
JMFF026G09+ GAAAGAGAGAGCCACGCTTCCTGAAGCTAAGAAGCGTAGGGTAATGAA
JMFF020N20+ GAAAGAGAGAGCCACGCTTCCTGAAGCTAAGAAGCGTAGGGTAATGAAAGAGGCGTAAGT
JMFS035G02+ GATAGAGAGAGCCGCGCTTCGTGAAGGTTATGTGTGTAGGGTAATGACATAGGCGTAAGT
JMFF012E23+ GAAAGAGAGAGCCACGCTTCCTGAAGCTAAGAAGCGTAGGGTAATGAAAGAGGCGTAAGT
                      ____________________________________________________________
consensus GAAAGAGAGAGCCACGCTTCCTGAAGCTAAGAAGCGTAGGGTAATGAAAGAGGCGTAAGT
 
. : . : . : . : . : . :
JMFF020N20+ ATAGCTAGACGGGAATATTTAAAGCAGCAACTGCAAGAGAAAATCCAAATGAGGGAAGAC
JMFS035G02+ CTAGCTAGACGGGGATATTTAAAGCAGCAGCTGCA
JMFF012E23+ ATAGCTAGACGGGAATATTTAAAGCAGCAACTGCAAGAGAAAATCCAAATGAGGGAAGAC
                      ____________________________________________________________
consensus ATAGCTAGACGGGAATATTTAAAGCAGCAACTGCAAGAGAAAATCCAAATGAGGGAAGAC