Previous Contig 000642:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012D10Sequence335000642 (16)529000642 (16)
JMFF030C11Sequence319000642 (16)526000642 (16)
JMFN010E19Sequence479000642 (16)
JMFN012J08Sequence522000642 (16)
JMFN013C21Sequence407000642 (16)
JMFN029G09Sequence512000642 (16)
JMFN030P14Sequence500000642 (16)
JMFN032G21Sequence528000642 (16)
JMFN042O12Sequence522000642 (16)
JMFN044P02Sequence529000642 (16)
JMFS040A07Sequence377000642 (16)
JMFS050D11Sequence521000642 (16)
JMFS069A05Sequence526000642 (16)
JMFS074B09Sequence530000642 (16)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN010E19+ ATAAAAAT
JMFN029G09+ ATAAAAAT
JMFN030P14+ ATAAAAAT
JMFN013C21+ ATAAAAAT
JMFN012J08+ ATAAAAAT
JMFN042O12+ ATAAAAAT
JMFN032G21+ ATAAAAAT
JMFS069A05+ ATAAAAAT
JMFS050D11+ ATAAAAAT
JMFN044P02+ ATAAAAAT
JMFS074B09+ ATAAAAAT
                      ____________________________________________________________
consensus ATAAAAAT
 
. : . : . : . : . : . :
JMFN010E19+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
JMFN029G09+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATTCCCAAATTATTCAAC
JMFN030P14+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
JMFN013C21+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
JMFN012J08+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTAAAC
JMFN042O12+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
JMFN032G21+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
JMFS069A05+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
JMFS050D11+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
JMFN044P02+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
JMFS074B09+ CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
rJMFF030C11- TAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
rJMFF012D10- TTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
                      ____________________________________________________________
consensus CAATTATATTATAATAAATATCACGAATATGTCCAAGGTACAATCCCCAAATTATTCAAC
 
. : . : . : . : . : . :
JMFN010E19+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFN029G09+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFN030P14+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFN013C21+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFN012J08+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFN042O12+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFN032G21+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFS069A05+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFS050D11+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFN044P02+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
JMFS074B09+ AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
rJMFF030C11- AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
rJMFF012D10- AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
                      ____________________________________________________________
consensus AATATCAAAGAATTCATCTCGAAAACCAAAACAGAAAACGAAGCTCTCATATATATTTCC
 
. : . : . : . : . : . :
JMFN010E19+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFN029G09+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTTGTAATAAATTGAGCG
JMFN030P14+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFN013C21+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFS040A07+ TAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFN012J08+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFN042O12+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFN032G21+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFS069A05+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFS050D11+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFN044P02+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
JMFS074B09+ TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
rJMFF030C11- TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
rJMFF012D10- TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
                      ____________________________________________________________
consensus TTTCAGAAATCTGAAAGGACTAATCTCCAGAGCCATGGCCTGTTCGTAATAAATTGAGCG
 
. : . : . : . : . : . :
JMFN010E19+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFN029G09+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFN030P14+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFN013C21+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFS040A07+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFN012J08+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFN042O12+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFN032G21+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFS069A05+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFS050D11+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFN044P02+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFS074B09+ TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
rJMFF030C11- TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
rJMFF012D10- TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
JMFF030C11+ CCGATTTNGACGAGGAATCCAA
JMFF012D10+ CTTCATAGCTTCCCCGATTTAGNCGNGGAATCCNA
                      ____________________________________________________________
consensus TTTTGAACACCAAATAGACGGTGTACTTCATAGCTTCACCGATTTAGACGAGGAATCCAA
 
. : . : . : . : . : . :
JMFN010E19+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFN029G09+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFN030P14+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFN013C21+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFS040A07+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGAAGATAG
JMFN012J08+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFN042O12+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFN032G21+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFS069A05+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFS050D11+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFN044P02+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFS074B09+ ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
rJMFF030C11- ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
rJMFF012D10- ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
JMFF030C11+ ATGCCNGAGCAACGNCGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATNGGAGGAAG
JMFF012D10+ ATGCCNGAGCNACGNCGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCNTCGGAGGAAG
                      ____________________________________________________________
consensus ATGCCAGAGCAACGACGGAGGCCAAAGCGGCGGGAACAAAAGCGACGGCATCGGAGGAAG
 
. : . : . : . : . : . :
JMFN010E19+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFN029G09+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFN030P14+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFN013C21+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFS040A07+ AGAAGCCGGTCCCCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFN012J08+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFN042O12+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFN032G21+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFS069A05+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFS050D11+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFN044P02+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFS074B09+ GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
rJMFF030C11- GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
rJMFF012D10- GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
JMFF030C11+ GGCCG-GGTGCCNCTGCAGGAGGATCANCCGCGGCTGCGCTTTGGACGGCGGAGAGCNCC
JMFF012D10+ GGCCG-GGTGCCNCTGCAGGAGGATCANCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
                      ____________________________________________________________
consensus GGCCG-GGTGCCGCTGCAGGAGGATCAGCCGCGGCTGCGCTTTGGACGGCGGAGAGCGCC
 
. : . : . : . : . : . :
JMFN010E19+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFN029G09+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFN030P14+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFN013C21+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGT
JMFS040A07+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFN012J08+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFN042O12+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFN032G21+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFS069A05+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFS050D11+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTN
JMFN044P02+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFS074B09+ ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
rJMFF030C11- ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
rJMFF012D10- ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
JMFF030C11+ CCGAGAGCCNTGATGAGAGCNGNGAAGAAAACTTTAGCGTTCATTGCCTCCNTTTTTGTT
JMFF012D10+ CCGAGAGCCNTGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCNTTTTTGTT
                      ____________________________________________________________
consensus ACGAGAGCCATGATGAGAGCAGCGAAGAAAACTTTAGCGTTCATTGCCTCCATTTTTGTT
 
. : . : . : . : . : . :
JMFN010E19+ TGTTTTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGG
JMFN029G09+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFN030P14+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFS040A07+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFN012J08+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFN042O12+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFN032G21+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFS069A05+ TG-TTTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFS050D11+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFN044P02+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFS074B09+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
rJMFF030C11- TG--TTTTTTTTTTTGNGNGNGTANATAATACAGAGTAAAATANAATGATGGATGAGTCA
rJMFF012D10- TG--TTTTTTTTTTTGNGNGNGTANATAATACANAGTAAAATANAATGATGGATGAGTCA
JMFF030C11+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
JMFF012D10+ TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
                      ____________________________________________________________
consensus TG--TTTTTTTTTTTGTGTGTGTAGATAATACAGAGTAGAATAGAATGATGGATGAGTCA
 
. : . : . : . : . : . :
JMFN029G09+ AAATCTGTGAAGAAATAGAGAATTTCT
JMFN030P14+ AAATCTGTGAAGAAA
JMFS040A07+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAA
JMFN012J08+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAAG
JMFN042O12+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAAG
JMFN032G21+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAAGGAATGG
JMFS069A05+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAAGGAA
JMFS050D11+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAA
JMFN044P02+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAAGGAATGGA
JMFS074B09+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAAGGAATGGAG
rJMFF030C11- AAATCTGNGAAAAAATAAANAATTTCTTTCACAAAAGGAATGGAGGAAAAATGGAATGGT
rJMFF012D10- AAATCTGTGAANAAATAAANAATTTCTTTCACAAAAGGAATGGAGGAAAAATGGAATGGT
JMFF030C11+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAAGGAATGGAGGAAGAATGGAATGGT
JMFF012D10+ AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAAGGAATGGAGGAAGAATGGAATGGT
                      ____________________________________________________________
consensus AAATCTGTGAAGAAATAGAGAATTTCTTTCACAGAAGGAATGGAGGAAGAATGGAATGGT