Previous Contig 000640:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002E23Sequence543000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.229000640 (61)gb:AF130978_17708332e-26Ipomoea batatas B12D protein mRNA, complete cds.
JMFF003N21Sequence511000640 (61)gb:AF130978_17708331e-43Ipomoea batatas B12D protein mRNA, complete cds.540000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFF006B01Sequence528000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.578000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFF006O15Sequence586000640 (61)gb:AF130978_17708338e-45Ipomoea batatas B12D protein mRNA, complete cds.562000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFF012C18Sequence597000640 (61)gb:AF130978_17708338e-45Ipomoea batatas B12D protein mRNA, complete cds.572000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFF021P20Sequence464000640 (61)gb:AF130978_17708334e-45Ipomoea batatas B12D protein mRNA, complete cds.568000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFF028H21Sequence529000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.555000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFF029C10Sequence539000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.571000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFF029K21Sequence510000640 (61)gb:AF130978_17708335e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFF029K22Sequence510000640 (61)gb:AF130978_17708335e-45Ipomoea batatas B12D protein mRNA, complete cds.516000640 (61)gb:AF130978_17708331e-42Ipomoea batatas B12D protein mRNA, complete cds.
JMFF029L13Sequence483000640 (61)gb:AF130978_17708335e-45Ipomoea batatas B12D protein mRNA, complete cds.418000640 (61)gb:AF130978_17708331e-28Ipomoea batatas B12D protein mRNA, complete cds.
JMFF029L21Sequence485000640 (61)gb:AF130978_17708335e-45Ipomoea batatas B12D protein mRNA, complete cds.518000640 (61)gb:AF130978_17708331e-40Ipomoea batatas B12D protein mRNA, complete cds.
JMFF029L22Sequence557000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.418000640 (61)gb:AF130978_17708331e-27Ipomoea batatas B12D protein mRNA, complete cds.
JMFF033N19Sequence566000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.574000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFF036H23Sequence541000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.671000640 (61)gb:AF130978_17708331e-44Ipomoea batatas B12D protein mRNA, complete cds.
JMFF043M06Sequence634000640 (61)gb:AF130978_17708339e-45Ipomoea batatas B12D protein mRNA, complete cds.609000640 (61)gb:AF130978_17708332e-33Ipomoea batatas B12D protein mRNA, complete cds.
JMFF048C06Sequence265000640 (61)gb:AF130978_17708336e-28Ipomoea batatas B12D protein mRNA, complete cds.634021806gb:AF130978_17708338e-04Ipomoea batatas B12D protein mRNA, complete cds.
JMFF048D06Sequence450000640 (61)gb:AF130978_17708332e-44Ipomoea batatas B12D protein mRNA, complete cds.398000640 (61)gb:AF130978_17708335e-16Ipomoea batatas B12D protein mRNA, complete cds.
JMFF049A13Sequence505000640 (61)gb:AF130978_17708335e-45Ipomoea batatas B12D protein mRNA, complete cds.449000640 (61)gb:AF130978_17708334e-30Ipomoea batatas B12D protein mRNA, complete cds.
JMFN004B14Sequence524000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN005P07Sequence563000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN006H08Sequence557000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN008J10Sequence562000640 (61)gb:AF130978_17708338e-44Ipomoea batatas B12D protein mRNA, complete cds.
JMFN012F02Sequence542000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN013F23Sequence587000640 (61)gb:AF130978_17708338e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN015K15Sequence557000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN017B15Sequence543000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN019P16Sequence469000640 (61)gb:AF130978_17708332e-34Ipomoea batatas B12D protein mRNA, complete cds.
JMFN025M15Sequence516000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN030M23Sequence560000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN032P13Sequence557000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN033B10Sequence178000640 (61)gb:AF130978_17708332e-20Ipomoea batatas B12D protein mRNA, complete cds.
JMFN038H01Sequence514000640 (61)gb:AF130978_17708335e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN039K09Sequence555000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFN042N18Sequence313000640 (61)gb:AF130978_17708335e-37Ipomoea batatas B12D protein mRNA, complete cds.
JMFN043A21Sequence556000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMFS167B10Sequence557000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMSF048P21Sequence586000640 (61)gb:AF130978_17708338e-45Ipomoea batatas B12D protein mRNA, complete cds.542000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMSF049A18Sequence575000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.519000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMSF049N15Sequence560000640 (61)gb:AF130978_17708337e-45Ipomoea batatas B12D protein mRNA, complete cds.516000640 (61)gb:AF130978_17708336e-45Ipomoea batatas B12D protein mRNA, complete cds.
JMSF049P21Sequence648006684 (6)gb:AY500156_16096481e-17Lycopersicon esculentum MAP3Ka mRNA, complete cds.527000640 (61)gb:AF130978_17708331e-41Ipomoea batatas B12D protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043M06- ACATAACCAAAAAT
                      ____________________________________________________________
consensus ACATAACCAAAAAT
 
. : . : . : . : . : . :
rJMFF043M06- CAAATTCCATAACTGTATTTTAAAAAGTTATCAACCAAACATTAGCTATGACTTTGACTC
rJMFF036H23- TAACTGTATTTTAAAAAGTTATCAACCAAACATTAGCTATGATTTTGACTC
                      ____________________________________________________________
consensus CAAATTCCATAACTGTATTTTAAAAAGTTATCAACCAAACATTAGCTATGATTTTGACTC
 
. : . : . : . : . : . :
rJMFF043M06- TCATTCCTAGTGTGTAAACCCATAAACTAACCACAACCTAAGGTAACTGTCATCTAGAAA
JMFN043A21+ AGAAA
JMFN030M23+ AGAAA
JMFN012F02+ AGAAA
JMFN019P16+ AA
rJMFF049A13- AGAAA
JMFN017B15+ AGAAA
rJMFF036H23- TCATTCCTAGTGTGTAAACCCATAAACTAACCACAACCTAAGGTAACTGTCATCTAGAAA
                      ____________________________________________________________
consensus TCATTCCTAGTGTGTAAACCCATAAACTAACCACAACCTAAGGTAACTGTCATCTAGAAA
 
. : . : . : . : . : . :
rJMFF043M06- AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN043A21+ AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN030M23+ AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGTGGTACAACATCCACG-TTTT
JMFN012F02+ AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN019P16+ AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF049A13- AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN017B15+ AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFF029L22+ AACAAGAGAATACTGTAAATATCACATTACTNTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF036H23- AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFF002E23+ AACAAGAGAATACTGTAAATATCACATTACTNTAAGTGGGGGTACAACATCCACG-TTTT
JMSF049A18+ AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN025M15+ TAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF029K22- TTACTCTGAGTGGGGGTACNACATCCACG-TTTT
JMFN005P07+ GAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN008J10+ AGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFS167B10+ ACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF003N21- ATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN006H08+ ACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN032P13+ ACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN015K15+ TACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFN039K09+ ACTGTAAATATCACATTA--CTAAGTGGGGGTACAACATCCACG-TTTT
JMFF003N21+ G-TTTT
JMFN013F23+ AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF006O15- TTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMSF048P21+ TTTTTTTTACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF048D06- CTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFF043M06+ CTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF012C18- TTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFF029L21+ T
JMFF006O15+ AATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACGTTTTT
rJMFF021P20- TACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFF029K22+ AAGTGGGGGTACAACATCCACG-TTTT
JMFF029K21+ AAGTGGGGGTACAACATCCACG-TTTT
rJMFF006B01- AATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF029C10- TTACTCTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF033N19- CATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
rJMFF028H21- AAGTGGGGGTACAACATCCACG-TTTT
rJMSF048P21- CATCCACG-TTTT
rJMSF049A18- ACATCCACG-TTTT
rJMSF049N15- ACATCCACG-TTTT
rJMFF029L21- GTGGGGGTACNACATCCACG-TTTT
JMFF033N19+ TAAGTGGGGGTACAACATCCACG-TTTT
JMSF049N15+ TTTTTTTTTTACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
JMFF036H23+ TT
JMFF029C10+ T
JMFF012C18+ TTTTTTTTTTACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
                      ____________________________________________________________
consensus AACAAGAGAATACTGTAAATATCACATTACTCTAAGTGGGGGTACAACATCCACG-TTTT
 
. : . : . : . : . : . :
rJMFF043M06- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN043A21+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN030M23+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN012F02+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN019P16+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF049A13- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN017B15+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF029L22+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF036H23- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF029L22- GATAANTTCTTAGTACATTACCTTGA
rJMFF029L13- AAGATANGTTCTTAGTACATTACCTTGA
JMFF002E23+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMSF049A18+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN025M15+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF029K22- TCATGTTTTACAGAACCCANATTCANTANATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN005P07+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN008J10+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFS167B10+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF003N21- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN006H08+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN032P13+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN015K15+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN039K09+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF003N21+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN013F23+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF006O15- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMSF048P21+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF048D06- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF043M06+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF012C18- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN004B14+ CATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF029L21+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF006O15+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF021P20- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF029K22+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF029K21+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF006B01- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF029C10- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF033N19- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF028H21- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMSF048P21- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMSF049A18- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMSF049N15- TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMFF029L21- TCATGTTTTACAGAACCCNNATTCANTANATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF033N19+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMSF049N15+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF036H23+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
rJMSF049P21- GTTTTACAGAANCCAAATTCAGTANATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF029C10+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFN038H01+ ACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF006B01+ TACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF028H21+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF049A13+ GAAGATAAGTTCTAGGTACATTACCTTGA
JMFF029L13+ CATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
JMFF012C18+ TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
                      ____________________________________________________________
consensus TCATGTTTTACAGAACCCAAATTCAGTAGATGAAGATAAGTTCTTAGTACATTACCTTGA
 
. : . : . : . : . : . :
rJMFF043M06- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN043A21+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN030M23+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN012F02+ TGCACCATGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN019P16+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF049A13- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN017B15+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF029L22+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF036H23- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF029L22- TGCANCCTGTTCTTGGGGGCAACCATTCAAACACGAAT-GTTTATAACACAAACACAATT
rJMFF029L13- TGCACCCTGTTCTTGGGGGCAACCATTCANACACGAAT-GTTTATAACACAAACACAATT
JMFF002E23+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMSF049A18+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN025M15+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF029K22- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACNAAT-GTTTATAACACAAACACAATT
JMFN005P07+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN008J10+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFS167B10+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF003N21- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN006H08+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN032P13+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN015K15+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN039K09+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF003N21+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN013F23+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF006O15- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMSF048P21+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF048D06- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF043M06+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF012C18- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN004B14+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF029L21+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF006O15+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF021P20- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF029K22+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF029K21+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF006B01- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF029C10- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF033N19- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF028H21- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMSF048P21- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMSF049A18- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMSF049N15- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMFF029L21- TGCACCCTGTTCTTGGGGGCAACCATTCAAACACNAAT-GTTTATAACACAAACACAATT
JMFF033N19+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMSF049N15+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF036H23+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
rJMSF049P21- TGCACCCTGTTCTTGGGGGCAACNATTCNAACACAAAGTGTTTATAACACAAACACANTT
JMFF029C10+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFN038H01+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF006B01+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF028H21+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF049A13+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF029L13+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF021P20+ TTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
JMFF048D06+ CATTCAAACACAAATGGTTTATAACACAAACACAATT
JMFF012C18+ TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
                      ____________________________________________________________
consensus TGCACCCTGTTCTTGGGGGCAACCATTCAAACACAAAT-GTTTATAACACAAACACAATT
 
. : . : . : . : . : . :
rJMFF043M06- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN043A21+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN030M23+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTA-AGT
JMFN012F02+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN019P16+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF049A13- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN017B15+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF029L22+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF036H23- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF029L22- ATTATCCCNGCATAAATGACAGGAGTTCANATCCCATAACTTGGGAGNCATGCTTACAGN
rJMFF029L13- ATTATCCCAGCATNAATGACAGGAGTTCNNATCCCATANCTTGGGAGNCATGCTTACAGT
JMFF002E23+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMSF049A18+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN025M15+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF029K22- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGNCATGCTTACAGT
JMFN005P07+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN008J10+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFS167B10+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF003N21- ATTATCCCAGCATAAATCACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN006H08+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN032P13+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN015K15+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN039K09+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF003N21+ ATTATCCCAGCATAAATCACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN013F23+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF006O15- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMSF048P21+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF048D06- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF043M06+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF012C18- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN004B14+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF029L21+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF006O15+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF021P20- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF029K22+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF029K21+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF006B01- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF029C10- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF033N19- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF028H21- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMSF048P21- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMSF049A18- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMSF049N15- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMFF029L21- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGNCATGCTTACAGT
JMFF033N19+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMSF049N15+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF036H23+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
rJMSF049P21- ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF029C10+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFN038H01+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF006B01+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF028H21+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF049A13+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF029L13+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF021P20+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF048D06+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
JMFF012C18+ ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
                      ____________________________________________________________
consensus ATTATCCCAGCATAAATGACAGGAGTTCAAATCCCATAACTTGGGAGTCATGCTTACAGT
 
. : . : . : . : . : . :
rJMFF043M06- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN043A21+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN030M23+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN012F02+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN019P16+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF049A13- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN017B15+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF029L22+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF036H23- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF029L22- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAANAAACGGTTGAGGGATGGCATTATTTC
rJMFF029L13- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAANAAACGGTTGAGGGATGGCATTATTTC
JMFF002E23+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF002E23- GGATGGNATTATTTC
JMSF049A18+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN025M15+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF029K22- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN005P07+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN008J10+ TCCAGGCAATTAATTGCGCTGAGGGTAACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFS167B10+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF003N21- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN006H08+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN032P13+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN015K15+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN039K09+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF003N21+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTN
JMFN013F23+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF006O15- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMSF048P21+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF048D06- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF043M06+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF012C18- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN004B14+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF029L21+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF006O15+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF021P20- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF029K22+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF029K21+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF006B01- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF029C10- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF033N19- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF028H21- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMSF048P21- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMSF049A18- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMSF049N15- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMFF029L21- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF033N19+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMSF049N15+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF036H23+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
rJMSF049P21- TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGNTGAGGGATGGCATTATTTC
JMFF029C10+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN038H01+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF006B01+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF028H21+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF049A13+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF029L13+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF021P20+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFN042N18+ AATTAATTGCATTGAGGGTCACGGAAGAGACGGTGGGGGGATGACAGTATTTC
JMFF048D06+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
JMFF012C18+ TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
                      ____________________________________________________________
consensus TCCAGGCAATTAATTGCGCTGAGGGTCACTGAAGAAACGGTTGAGGGATGGCATTATTTC
 
. : . : . : . : . : . :
rJMFF043M06- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN043A21+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN030M23+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN012F02+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN019P16+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF049A13- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN017B15+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF029L22+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF036H23- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF029L22- TGGGCTCTTGNTGCGGACNAACTTTCNAAGAGAGNGCTCANCATACTTCTTCCCCTCCTC
rJMFF029L13- TGGGCTCTTGTTGCGGACAAACTTTCNAAGAGAGTGCTCANCATACTTCTTCCCCTCCTC
JMFF002E23+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF002E23- TGGGCTCTTGTTGCGGACNAACTTTCNAAGAGAGNGCTCANCATACTTCTTCCCCTCCTC
JMSF049A18+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN025M15+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF029K22- TGGGCTCTTGTTGCGGACNAACTTTCTAAGAGAGTGCTCANCATACTTCTTCCCCTCCTC
JMFN005P07+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN008J10+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFS167B10+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF003N21- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN006H08+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN032P13+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN015K15+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN039K09+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF003N21+ TGGGCTCTTGTTGCGGACAAACTTTNTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN013F23+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF006O15- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMSF048P21+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF048D06- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF043M06+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF012C18- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCTTCCTC
JMFN004B14+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF029L21+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF006O15+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF021P20- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF029K22+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF029K21+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF006B01- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF029C10- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF033N19- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF028H21- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMSF048P21- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMSF049A18- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMSF049N15- TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMFF029L21- TGGGCTCTTGTTGCGGACNAACTTTCNAAGAGAGTGCTCANCATACTTCTTCCCCTCCTC
JMFF033N19+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMSF049N15+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF036H23+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
rJMSF049P21- TGGGCTCTTGNTGCGGACAAACTTNCTAAGAGAGTGCTCANCATACTTCTTCCCCTCCTC
JMFF029C10+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN038H01+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF006B01+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF028H21+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF049A13+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF029L13+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF021P20+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFN042N18+ GGGGCTCTTGTGGCGGACAAACTTTGTAAGAGAGTGCTCAGCATACTTGTTGCCCTCCTC
JMFF048D06+ TGGGCTCTTGTTGCGGACAAACTTTGTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
JMFF048C06+ GCTCAGCATACTTCTTCCCCTCCTC
JMFF012C18+ TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCTTCCTC
                      ____________________________________________________________
consensus TGGGCTCTTGTTGCGGACAAACTTTCTAAGAGAGTGCTCAGCATACTTCTTCCCCTCCTC
 
. : . : . : . : . : . :
rJMFF043M06- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN043A21+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN030M23+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN012F02+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN019P16+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF049A13- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN017B15+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF029L22+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF036H23- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF029L22- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGNTAACCCTGACTTCAGGATTGGN
rJMFF029L13- ATAGTTCTCCANCACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTNCANGATTGGN
JMFF002E23+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF002E23- ATANNTCTCCANCACTCCCGCANCTCTTCCCTCCTTGTTAACCCTGACTNCNNGATTGGN
JMSF049A18+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN025M15+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF029K22- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN005P07+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN008J10+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFS167B10+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF003N21- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN006H08+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN032P13+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN015K15+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN039K09+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN033B10+ CCAACACTCCCGCAGGTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF003N21+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN013F23+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF006O15- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMSF048P21+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF048D06- ATAGTTCTCCA
JMFF043M06+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF012C18- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN004B14+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF029L21+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF006O15+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF021P20- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF029K22+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF029K21+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF006B01- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF029C10- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF033N19- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF028H21- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMSF048P21- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMSF049A18- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMSF049N15- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMFF029L21- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGN
JMFF033N19+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMSF049N15+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF036H23+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
rJMSF049P21- ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGN
JMFF029C10+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN038H01+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF006B01+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF028H21+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF049A13+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF029L13+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF021P20+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFN042N18+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTGGTTAACCCTGACTTCAGGATTGGT
JMFF048D06+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF048C06+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
JMFF012C18+ ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
                      ____________________________________________________________
consensus ATAGTTCTCCAACACTCCCGCAGCTCTTCCCTCCTTGTTAACCCTGACTTCAGGATTGGT
 
. : . : . : . : . : . :
rJMFF043M06- GGTGATATTCCGGAATCACTGANATCCACAGATTCCGACAGCAACGCCCATGGCCGC
JMFN043A21+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN030M23+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN012F02+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN019P16+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCC
rJMFF049A13- GGTGATATTCCGGATCAACTGAAATC
JMFN017B15+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF029L22+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF036H23- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF029L22- GGNGATATTCCGGATCAACTGAAATCCACAGATNCCGACAGCTACGCCCATGGCCGCAAA
rJMFF029L13- GGNGATATTCCGGATCNACTGAAATCCACANATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF002E23+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF002E23- GGNGATATTCCGGATCNACTGAAATCCACANATTCCGACAGCTACNCCCATGGCCGCAAA
JMSF049A18+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN025M15+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF029K22- GGNGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN005P07+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN008J10+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFS167B10+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF003N21- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN006H08+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN032P13+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN015K15+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN039K09+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN033B10+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF003N21+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN013F23+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF006O15- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMSF048P21+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF043M06+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCAACGCCCATGGCCGCAAA
rJMFF012C18- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN004B14+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF029L21+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF006O15+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF021P20- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF029K22+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF029K21+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF006B01- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF029C10- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF033N19- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF028H21- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMSF048P21- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMSF049A18- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMSF049N15- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMFF029L21- GGNGATATTCCGGATCNACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF033N19+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMSF049N15+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF036H23+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
rJMSF049P21- GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF029C10+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN038H01+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF006B01+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF028H21+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF049A13+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF029L13+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF021P20+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFN042N18+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCGGACAGCTACGCCCATGGCCGCAAA
JMFF048D06+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF048C06+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
JMFF012C18+ GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
                      ____________________________________________________________
consensus GGTGATATTCCGGATCAACTGAAATCCACAGATTCCGACAGCTACGCCCATGGCCGCAAA
 
. : . : . : . : . : . :
JMFN043A21+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN030M23+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN012F02+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTG
JMFN017B15+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATT-AAGAGAGCTGTGTTGC
JMFF029L22+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF036H23- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF029L22- CANTGGATAAACCTCNNGCCTGATCCAGCGG
rJMFF029L13- NANTGGATAAACCTCNGGCCTGATCCAGCGG
JMFF002E23+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF002E23- NANTGGATAAACCTCNGGCCTGATCCAGCGG
JMSF049A18+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN025M15+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCT
rJMFF029K22- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAANCCATTGAAGANAGCTGTGTTGC
JMFN005P07+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN008J10+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFS167B10+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF003N21- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN006H08+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN032P13+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN015K15+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN039K09+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN033B10+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF003N21+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN013F23+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF006O15- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMSF048P21+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF043M06+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF012C18- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN004B14+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF029L21+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF006O15+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF021P20- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF029K22+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF029K21+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF006B01- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF029C10- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF033N19- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF028H21- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMSF048P21- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMSF049A18- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMSF049N15- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMFF029L21- CANTGGATAAACCTCNGGCCTGATCCAGCGGCTANAAGCCATTGAAGAGAGCTGTGTTGC
JMFF033N19+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMSF049N15+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF036H23+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
rJMSF049P21- CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF029C10+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN038H01+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF006B01+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF028H21+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF049A13+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF029L13+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF021P20+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFN042N18+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF048D06+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF048C06+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
JMFF012C18+ CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
                      ____________________________________________________________
consensus CAGTGGATAAACCTCGGGCCTGATCCAGCGGCTAGAAGCCATTGAAGAGAGCTGTGTTGC
 
. : . : . : . : . : . :
JMFN043A21+ CTGTTGTGTTGTG
JMFN030M23+ CTGTTGTGTTGTGTTGAA
JMFN017B15+ C
JMFF029L22+ C
rJMFF036H23- CTGTTGTGTTGTGTTGAAGTAC
JMFF002E23+ CTGTT
JMSF049A18+ CTGTTGTGTTGTGTTGAAGTACAAAAC
rJMFF029K22- CAGT
JMFN005P07+ CTGTTGTGTTGTGTTAAAGTACAAAACACC
JMFN008J10+ CTGTTGTGTTGTGTTGAAGTACAAAACACC
JMFS167B10+ CTGTTGTGTTGTGTTGAAGTACAAAACACC
rJMFF003N21- CTGTTGTGTTGTGTTGAAGTACAAAAC
JMFN006H08+ CTGTTGTGTTGTGTTGAAGTACAAAACACC
JMFN032P13+ CTGTTGTGTTGTGTTGAAGTACAAAACACC
JMFN015K15+ CTGTTGTGTTGTG-TGAAGTACAAAACACC
JMFN039K09+ CTGTTGTGTTGTGTTGAAGTACAAAACACC
JMFN033B10+ CTGTTG
JMFF003N21+ CTGTTGTGTTGTGTTGAAGTACAAAAC
JMFN013F23+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGA
rJMFF006O15- CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGAC
JMSF048P21+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGAC
JMFF043M06+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGAC
rJMFF012C18- CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTGCAAC
JMFN004B14+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAG
JMFF029L21+ C
JMFF006O15+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGAC
rJMFF021P20- CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTC
JMFF029K22+ C
JMFF029K21+ C
rJMFF006B01- CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTC
rJMFF029C10- CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTCAA
rJMFF033N19- CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTCAAC
rJMFF028H21- CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGC
rJMSF048P21- CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGAC
rJMSF049A18- CTGTTGTGTTGTGTTGAAGTACAAAAC
rJMSF049N15- CTGTTGTGTTGTGTTGAAGTAC
rJMFF029L21- CAGTT
JMFF033N19+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTCAAC
JMSF049N15+ CTGTTGTGTTGTGTTGAAGTAC
JMFF036H23+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTCAAC
rJMSF049P21- CTGTTGTGTTGTGTTGAAGTACAAAACACCNAAAAAGAAAATGAANCGAC
JMFF029C10+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTCAA
JMFN038H01+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGA
JMFF006B01+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTC
JMFF028H21+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGC
JMFF049A13+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTC
JMFF029L13+ C
JMFF021P20+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTC
JMFN042N18+ CTGTTGTGTGGTGTTGAAGT
JMFF048D06+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGC
JMFF048C06+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTCAAC
JMFF012C18+ CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTGCAAC
                      ____________________________________________________________
consensus CTGTTGTGTTGTGTTGAAGTACAAAACACCAAAAAAGAAAATGAAGCGACAGATTTCAAC