Previous Contig 000628:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011P10Sequence537000628 (4)sp|O49954|GCSP_SOLTU3e-84Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G724010398 (12)gb:ASU11693_15426083e-90Avena sativa victorin binding protein mRNA, complete cds.
JMFF031E13Sequence466000628 (4)sp|O49852|GCSP_FLATR3e-74Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G109021352
JMFF044C19Sequence656000628 (4)sp|O49954|GCSP_SOLTUe-104Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G639010398 (12)sp|O49954|GCSP_SOLTU2e-38Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G
JMFF047G01Sequence436000628 (4)sp|O49852|GCSP_FLATR4e-67Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (G

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044C19+ TGCTTGCAGTCTATGAAGGTACCTAAGCAACTCGTGCTCGGTGTGGTACATGTTGAA
                      ____________________________________________________________
consensus TGCTTGCAGTCTATGAAGGTACCTAAGCAACTCGTGCTCGGTGTGGTACATGTTGAA
 
. : . : . : . : . : . :
JMFF044C19+ TATTGAGTGAGTTAAGAATGGACTCTCCCTTACTAGCCCAGTAGGGATCTTGTTTTGAAC
                      ____________________________________________________________
consensus TATTGAGTGAGTTAAGAATGGACTCTCCCTTACTAGCCCAGTAGGGATCTTGTTTTGAAC
 
. : . : . : . : . : . :
JMFF044C19+ TTCTGCTGCAATGGATTCAGCACTGAATGGCACTGGCTTTCCACCAGCAAAAACTTTGAA
JMFF011P10+ CTGCTGCAATGGATTCAGCACTGAATGGCACTGGCTTTCCACCAGCAAAAACTTTGAA
                      ____________________________________________________________
consensus TTCTGCTGCAATGGATTCAGCACTGAATGGCACTGGCTTTCCACCAGCAAAAACTTTGAA
 
. : . : . : . : . : . :
JMFF044C19+ TAGTTTGTCTACATCTTCTAAGGTGGTTGTCTCATCAAACGATACGGTGATAGTATTGCT
JMFF031E13+ TCTTCTAAGGTGGTTGTCTCATCAAACGATACGGTGATAGTATTGCT
JMFF047G01+ ACGGTGATAGTA-TGCT
JMFF011P10+ TAGTTTGTCTACATCTTCTAAGGTGGTTGTCTCATCAAACGATACGGTGATAGTATTGCT
                      ____________________________________________________________
consensus TAGTTTGTCTACATCTTCTAAGGTGGTTGTCTCATCAAACGATACGGTGATAGTATTGCT
 
. : . : . : . : . : . :
JMFF044C19+ GT-CCACAACCCGCAAGTTAATCTCATGTTTGTATGCAGCTTCAGCAATTGCTTTTGCAT
JMFF031E13+ GT-CCACAACCCGCAAGTTAATCTCATGTTTGTATGCAGCTTCAGCAATTGCTTTTGCAT
JMFF047G01+ GTCCCACAACCCGCAAGTTAATCTCATGTTNGTATGCAGCTTCAGCAATTGCTTTNGCAT
JMFF011P10+ GT-CCACAACCCGCAAGTTAATCTCATGTTTGTATGCAGCTTCAGCAATTGCTTTTGCAT
                      ____________________________________________________________
consensus GT-CCACAACCCGCAAGTTAATCTCATGTTTGTATGCAGCTTCAGCAATTGCTTTTGCAT
 
. : . : . : . : . : . :
JMFF044C19+ CAGTGCACTTAACCTTCACAGTGTCAAAGAAGGGAAGTTCCTGTACTTGTACTGTCCCCA
JMFF031E13+ CAGTGCACTTAACCTTCACAGTGTCAAAGAAGGGAAGTTCCTGTACTTGTACTGTCCCCA
JMFF047G01+ CAGTGCACTTAACCTTCACAGTGTCAAAGAAGGGAAGTTCCTGTACTTGTACTGTCCCCA
JMFF011P10+ CAGTGCACTTAACCTTCACAGTGTCAAAGAAGGGAAGTTCCTGTACTTGTACTGTCCCCA
                      ____________________________________________________________
consensus CAGTGCACTTAACCTTCACAGTGTCAAAGAAGGGAAGTTCCTGTACTTGTACTGTCCCCA
 
. : . : . : . : . : . :
JMFF044C19+ GCTTTTTCAGCCCAGATGCCAAAGTTCCAGCAAGACCATGAACACGTTGTGCAATTGTTT
JMFF031E13+ GCTTTTTCAGCCCAGATGCCAAAGTTCCAGCAAGACCATGAACACGTTGTGCAATTGTTT
JMFF047G01+ GCTTTTTCAGCCCAGATGCCAAAGTTCCAGCAAGACCATGAACACGTTGTGCAATTGTTT
JMFF011P10+ GCTTTTTCAGCCCAGATGCCAAAGTTCCAGCAAGACCATGAACACGTTGTGCAATTGTTT
                      ____________________________________________________________
consensus GCTTTTTCAGCCCAGATGCCAAAGTTCCAGCAAGACCATGAACACGTTGTGCAATTGTTT
 
. : . : . : . : . : . :
JMFF044C19+ TAAGCCCTTCAGGTCCATGATAAACAGCATACATGGCAGCCATATTGGCAAGCAATGCCT
JMFF031E13+ TAAGCCCTTCAGGTCCATGATAAACAGCATACATGGCAGCCATATTGGCAAGCAATGCCT
JMFF047G01+ TAAGCCCTTCAGGTCCATGATAAACAGCATACATGGCAGCCATATTGGCAAGCAATGCCT
JMFF011P10+ TAAGCCCTTCAGGTCCATGATAAACAGCATACATGGCAGCCATATTGGCAAGCAATGCCT
                      ____________________________________________________________
consensus TAAGCCCTTCAGGTCCATGATAAACAGCATACATGGCAGCCATATTGGCAAGCAATGCCT
 
. : . : . : . : . : . :
JMFF044C19+ GGGCAGTGCAAATGTTGCTGGTAGCTTTGTCCCTACGAATATGCTGCTCCCTAGTCTGCA
JMFF031E13+ GGGCAGTGCAAATGTTGCTGGTAGCTTTGTCCCTACGAATATGCTGCTCCCTAGTCTGCA
JMFF047G01+ GGGCAGTGCAAATGTTGCTGGTAGCTTTGTCCCTACGAATATGCTGCTCCCTAGTCTGCA
JMFF011P10+ GGGCAGTGCAAATGTTGCTGGTAGCTTTGTCCCTACGAATATGCTGCTCCCTAGTCTGCA
                      ____________________________________________________________
consensus GGGCAGTGCAAATGTTGCTGGTAGCTTTGTCCCTACGAATATGCTGCTCCCTAGTCTGCA
 
. : . : . : . : . : . :
JMFF044C19+ TTGCCATACGCAGAGCAGGCTTCCCAGAGGAATCAACACTAACCCCAATAATCCTTCCCG
JMFF031E13+ TTGCCATACGCAGAGCAGGCTTCCCAGAGGAATCAACACTAACCCCAATAATCCTTCCCG
JMFF047G01+ TTGCCATACGCAGAGCAGGCTTCCCAGAGGAATCAACACTAACCCCAATAATCCTTCCCG
JMFF011P10+ TTGCCATACGCAGAGCAGGCTTCCCAGAGGAATCAACACTAACCCCAATAATCCTTCCCG
                      ____________________________________________________________
consensus TTGCCATACGCAGAGCAGGCTTCCCAGAGGAATCAACACTAACCCCAATAATCCTTCCCG
 
. : . : . : . : . : . :
JMFF044C19+ GCATCATTCTCTTATACTCTTGTGATGTAGCCAAGAAGGCAGCATGGGGTCGTCCTTACC
JMFF031E13+ GCATCATTCTCTTATACTCTTGTGATGTAGCCAAGAAGGCAGCATGGGGTCGTCCTTACC
JMFF047G01+ GCATCATTCTCTTATACTCTTGTGATGTAGCCAAGAAGGCAGCATGGGGTCGTCCTTACC
JMFF011P10+ GCATCATTCTCTTATACTCTTGTGATGTAGCCAAGAAGGCAGCATGGGGTCGTCCTTACC
                      ____________________________________________________________
consensus GCATCATTCTCTTATACTCTTGTGATGTAGCCAAGAAGGCAGCATGGGGTCGTCCTTACC