Previous Contig 000620:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011M19Sequence466000620 (4)gb:BT000769_16350402e-34Arabidopsis thaliana clone RAFL09-16-C23 (R09389) unknown protein (At5g25754) mR745011497 (6)gb:BT000769_16350405e-71Arabidopsis thaliana clone RAFL09-16-C23 (R09389) unknown protein (At5g25754) mR
JMFF018B01Sequence567000620 (4)gb:BT000769_16350401e-53Arabidopsis thaliana clone RAFL09-16-C23 (R09389) unknown protein (At5g25754) mR705011497 (6)gb:BT000769_16350406e-78Arabidopsis thaliana clone RAFL09-16-C23 (R09389) unknown protein (At5g25754) mR
JMSF009E04Sequence384000620 (4)gb:BT000769_16350404e-47Arabidopsis thaliana clone RAFL09-16-C23 (R09389) unknown protein (At5g25754) mR818011497 (6)gb:BT000769_16350402e-94Arabidopsis thaliana clone RAFL09-16-C23 (R09389) unknown protein (At5g25754) mR
JMSF027M06Sequence626000620 (4)gb:BT000769_16350402e-73Arabidopsis thaliana clone RAFL09-16-C23 (R09389) unknown protein (At5g25754) mR754011497 (6)gb:BT000769_16350409e-91Arabidopsis thaliana clone RAFL09-16-C23 (R09389) unknown protein (At5g25754) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027M06+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMSF027M06+ GGCACGGTATTGGCAGAATGACTGAAATTGGTAAACAAATTCGTCAATCATATCCCACAA
                      ____________________________________________________________
consensus GGCACGGTATTGGCAGAATGACTGAAATTGGTAAACAAATTCGTCAATCATATCCCACAA
 
. : . : . : . : . : . :
JMSF027M06+ CCACTGGTTTGGCAATTGCATGTTTACCACCCCATGTAGAACCACCTGGAATAAGTTGCA
JMFF018B01+ CCATGTAGAACCACCTGGAATAAGTTGCA
                      ____________________________________________________________
consensus CCACTGGTTTGGCAATTGCATGTTTACCACCCCATGTAGAACCACCTGGAATAAGTTGCA
 
. : . : . : . : . : . :
JMSF027M06+ GTAATTGTCCCACGAATCAATACGCTGCTTGAGAGTCGGGGAGAGGCGAGCATAGAGGTG
JMSF009E04+ CCACGAATCAATACGCTGCTTGAGAGTCGGGGAGAGGCGAGCATAGAGGTG
JMFF018B01+ GTAATTGTCCCACGAATCAATACGCTGCTTGAGAGTCGGGGAGAGGCGAGCATAGAGGTG
                      ____________________________________________________________
consensus GTAATTGTCCCACGAATCAATACGCTGCTTGAGAGTCGGGGAGAGGCGAGCATAGAGGTG
 
. : . : . : . : . : . :
JMSF027M06+ GCGAAACCACATCTCCCGGTAAAGCAAGCAGAAGACATGGTCGTTGTCGACGTAAGGTGC
JMSF009E04+ GCGAAACCACATCTCCCGGTAAAGCAAGCAGAAGACATGGTCGTTGTCGACGTAAGGTGC
JMFF018B01+ GCGAAACCACATCTCCCGGTAAAGCAAGCAGAAGACATGGTCGTTGTCGACGTAAGGTGC
JMFF011M19+ CTCCCGGTAAAGCAAGCAGAAGACATGGTCGTTGTCGACGTAAGGTGC
                      ____________________________________________________________
consensus GCGAAACCACATCTCCCGGTAAAGCAAGCAGAAGACATGGTCGTTGTCGACGTAAGGTGC
 
. : . : . : . : . : . :
JMSF027M06+ GACTGCGTCAACAGAAGGCCAGGGAGTGTCCTTGAACATGCGCTCGCTGAGGCTCTGGAA
JMSF009E04+ GACTGCGTCAACAGAAGGCCAGGGAGTGTCCTTGAACATGCGCTCGCTGAGGCTCTGGAA
JMFF018B01+ GACTGCGTCAACAGAAGGCCAGGGAGTGTCCTTGAACATGCGCTCGCTGAGGCTCTGGAA
JMFF011M19+ GACTGCGTCAACAGAAGGCCAGGGAGTGTCCTTGAACATGCGCTCGCTGAGGCTCTGGAA
                      ____________________________________________________________
consensus GACTGCGTCAACAGAAGGCCAGGGAGTGTCCTTGAACATGCGCTCGCTGAGGCTCTGGAA
 
. : . : . : . : . : . :
JMSF027M06+ CGAAGTCTCGTACATCTGGTGGATCTCGTACACATTCTTCTCCCTAATGTGCCTGTAAAG
JMSF009E04+ CGAAGTCTCGTACATCTGGTGGATCTCGTACACATTCTTCTCCCTAATGTGCCTGTAAAG
JMFF018B01+ CGAAGTCTCGTACATCTGGTGGATCTCGTACACATTCTTCTCCCTAATGTGCCTGTAAAG
JMFF011M19+ CGAAGTCTCGTACATCTGGTGGATCTCGTACACATTCTTCTCCCTAATGTGCCTGTAAAG
                      ____________________________________________________________
consensus CGAAGTCTCGTACATCTGGTGGATCTCGTACACATTCTTCTCCCTAATGTGCCTGTAAAG
 
. : . : . : . : . : . :
JMSF027M06+ ATGGCCGACGAACGACTTCACCGGGTCTGGGACGTAGTTCGGGTCATACGACTCGAGTGA
JMSF009E04+ ATGGCCGACGAACGACTTCACCGGGTCTGGGACGTAGTTCGGGTCATACGACTCGAGTGA
JMFF018B01+ ATGGCCGACGAACGACTTCACCGGGTCTGGGACGTAGTTCGGGTCATACGACTCGAGTGA
JMFF011M19+ ATGGCCGACGAACGACTTCACCGGGTCTGGGACGTAGTTCGGGTCATACGACTCGAGTGA
                      ____________________________________________________________
consensus ATGGCCGACGAACGACTTCACCGGGTCTGGGACGTAGTTCGGGTCATACGACTCGAGTGA
 
. : . : . : . : . : . :
JMSF027M06+ AGAGTCCGAGTGCTGCTGTTTGGTCGAGTAGCTGCCATCTTCGTAGTCGTATGAAGTCGC
JMSF009E04+ AGAGTCCGAGTGCTGCTGTTTGGTCGAGTAGCTGCCATCTTCGTAGTCGTATGAAGTCGC
JMFF018B01+ AGAGTCCGAGTGCTGCTGTTTGGTCGAGTAGCTGCCATCTTCGTAGTCGTATGAAGTCGC
JMFF011M19+ AGAGTCCGAGTGCTGCTGTTTGGTCGAGTAGCTGCCATCTTCGTAGTCGTATGAAGTCGC
                      ____________________________________________________________
consensus AGAGTCCGAGTGCTGCTGTTTGGTCGAGTAGCTGCCATCTTCGTAGTCGTATGAAGTCGC
 
. : . : . : . : . : . :
JMSF027M06+ CATTGTTGACGTCTGATTCGCAGAGAGGCTCCTGTTTTTGCTTTCTCCGAGACAAGGGTT
JMSF009E04+ CATTGTTGACGTCTGATTCGCA
JMFF018B01+ CATTGTTGACGTCTGATTCGCACAGGATTTCC--TTTTTGCTTTCTCCGAGACAAGGGTT
JMFF011M19+ CATTGTTGACGTCTGATTCGCACAGGATTTCC--TTTTTGCTTTCTCCGAGACAAGGGTT
                      ____________________________________________________________
consensus CATTGTTGACGTCTGATTCGCACAGGATTTCC--TTTTTGCTTTCTCCGAGACAAGGGTT
 
. : . : . : . : . : . :
JMSF027M06+ TATCTATAAAGACGTTGAGGTCTGATTCGCACAGGATTTCCTTTTCTCCCTGCGAGACTA
JMFF018B01+ TATCTATAAAGACGTTGAGGTCTGATTCGCACAGGATTTCCTTTTCTCCCTGCGAGACTA
JMFF011M19+ TATCTATAAAGACGTTGAGGTCTGATTCGCACAGGATTTCCTTTTCTCCCTGCGAGACTA
                      ____________________________________________________________
consensus TATCTATAAAGACGTTGAGGTCTGATTCGCACAGGATTTCCTTTTCTCCCTGCGAGACTA
 
. : . : . : . : . : . :
JMSF027M06+ GGGTTTACCGAGGAAGACGATAAT
JMFF018B01+ GGGTTTACCGAGGAAGACGATAATGAAGCAAAGGCCGGGAATATTGGGTGACTTTGCCC
JMFF011M19+ GGGTTTACCGAGGAAGACGATAATGAAGCAAAGGCCGGGAATATTGGGTGACTTTGCCCG
                      ____________________________________________________________
consensus GGGTTTACCGAGGAAGACGATAATGAAGCAAAGGCCGGGAATATTGGGTGACTTTGCCCG