Previous Contig 000612:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011K16Sequence590000612 (9)gb:AF205069_17767094e-71Lycopersicon esculentum xyloglucan endotransglycosylase (BR1) mRNA, partial cds.668000612 (9)sp|P35694|BRU1_SOYBN1e-62Brassinosteroid-regulated protein BRU1 precursor.>pir|T07678|T07678 xyloglucan e
JMFF017H16Sequence570000612 (9)gb:AF205069_17767092e-71Lycopersicon esculentum xyloglucan endotransglycosylase (BR1) mRNA, partial cds.744000612 (9)sp|P35694|BRU1_SOYBN2e-83Brassinosteroid-regulated protein BRU1 precursor.>pir|T07678|T07678 xyloglucan e
JMFF024A07Sequence368000612 (9)gb:AF205069_17767094e-30Lycopersicon esculentum xyloglucan endotransglycosylase (BR1) mRNA, partial cds.604000612 (9)sp|P35694|BRU1_SOYBN1e-59Brassinosteroid-regulated protein BRU1 precursor.>pir|T07678|T07678 xyloglucan e
JMFN010K06Sequence625000612 (9)sp|P35694|BRU1_SOYBN2e-88Brassinosteroid-regulated protein BRU1 precursor.>pir|T07678|T07678 xyloglucan e
JMSF052N07Sequence651000612 (9)sp|P35694|BRU1_SOYBN1e-82Brassinosteroid-regulated protein BRU1 precursor.>pir|T07678|T07678 xyloglucan e964000612 (9)sp|P35694|BRU1_SOYBNe-125Brassinosteroid-regulated protein BRU1 precursor.>pir|T07678|T07678 xyloglucan e

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF011K16- ATTTAAACCAACTATTTAGATCATAGATACACAGAAGGGGCCCCAAAGTGGCAAAG
rJMFF024A07- TATTTAGATCATAGATACACAGAAGGGGCCCCAAAGTGGCAAAG
rJMFF017H16- TATTTAGATCATAGATACACAGAAGGGGCCCCAAAGTGGCAAAG
                      ____________________________________________________________
consensus ATTTAAACCAACTATTTAGATCATAGATACACAGAAGGGGCCCCAAAGTGGCAAAG
 
. : . : . : . : . : . :
rJMFF011K16- TACAAAGCATCCCATTTTTATTACAAGAGCAAGTAGTATATGTAAAACTAGGAACAAAAA
rJMFF024A07- TACAAAGCATCCCATTTTTATTACAAGAGCAAGTAGTATATGTAAAACTAGGAACAAAAA
rJMFF017H16- TACAAAGCATCCCATTTTTATTACAAGAGCAAGTAGTATATGTAAAACTAGGAACAAAAA
rJMSF052N07- AGAGCANGTAGTATATGTAAAACTAGGAACAAAAA
                      ____________________________________________________________
consensus TACAAAGCATCCCATTTTTATTACAAGAGCAAGTAGTATATGTAAAACTAGGAACAAAAA
 
. : . : . : . : . : . :
rJMFF011K16- CAAAAGAATTTCAAACACAAATTATGATACAATCTCCAGCCCAATTATACATCCCTTTTG
rJMFF024A07- CAAAAGAATTTCAAACACAAATTATGATACAATCTCCAGCCCAATTATACATCCCTTTTG
rJMFF017H16- CAAAAGAATTTCAAACACAAATTATGATACAATCTCCAGCCCAATTATACATCCCTTTTG
JMFN010K06+ AATTATGATACAATCTCCAGCCCAATTATACATCCCTTTTG
rJMSF052N07- CAAAAGAATTTCAAACACAAATTATGATACAATCTCCAGCCCAATTATACATCCCTTTTG
                      ____________________________________________________________
consensus CAAAAGAATTTCAAACACAAATTATGATACAATCTCCAGCCCAATTATACATCCCTTTTG
 
. : . : . : . : . : . :
rJMFF011K16- TGTTTTTCTTTTGATGAGGAACCATCANAAATGTCTGCACTCTGCAGGGAAGCCCTGAGG
rJMFF024A07- TGTTTTTCTTTTGATGAGGAACCATCANAAATGTCTGCACTCTGCAGGGAAGCCCTGAGG
rJMFF017H16- TGTTTTTCTTTTGATGAGGAACCATCANAAATGTCTGCACTCTGCAGGGAAGCCCTGAGG
JMFN010K06+ TGTTTTTCTTTTGATGAGGAACCATCAGAAATGTCTGCACTCTGCAGGGAAGCCCTGAGG
rJMSF052N07- TGTTTTTCTTTTGATGAGGAACCATCAGAAATGTCTGCACTCTGCAGGGAAGCCCTGAGG
                      ____________________________________________________________
consensus TGTTTTTCTTTTGATGAGGAACCATCAGAAATGTCTGCACTCTGCAGGGAAGCCCTGAGG
 
. : . : . : . : . : . :
rJMFF011K16- AAAACGTTTATAATCAGTGCAGTAATTGTAAATCATGAAGTTCTTCTGAACCCATCTGAG
rJMFF024A07- AAAACGTTTATAATCAGTGCAGTAATTGTAAATCATGAAGTTCTTCTGAACCCATCTGAG
rJMFF017H16- AAAACGTTTATAATCAGTGCAGTAATTGTAAATCATGAAGTTCTTCTGAACCCATCTGAG
JMFN010K06+ AAAACGTTTATAATCAGTGCAGTAATTGTAAATCATGAAGTTCTTCTGAACCCATCTGAG
rJMSF052N07- AAAACGTTTATAATCAGTGCAGTAATTGTAAATCATGAAGTTCTTCTGAACCCATCTGAG
                      ____________________________________________________________
consensus AAAACGTTTATAATCAGTGCAGTAATTGTAAATCATGAAGTTCTTCTGAACCCATCTGAG
 
. : . : . : . : . : . :
rJMFF011K16- CCTTCTTCTGCCATAGGCATCAAGCTCTTGGCTCTGCCATTTCCCATCATTAAACTGGGA
rJMFF024A07- CCTTCTTCTGCCATAGGCATCAAGCTCTTGGCTCTGCCATTTCCCATCATTAAACTGGGA
rJMFF017H16- CCTTCTTCTGCCATAGGCATCAAGCTCTTGGCTCTGCCATTTCCCATCATTCAACTGGGA
JMFN010K06+ CCTTCTTCTGCCATAGGCATCAAGCTCTTGGCTCTGCCATTTCCCATCATTAAACTGGGA
rJMSF052N07- CCTTCTTCTGCCATAGGCATCAAGCTCTTGGCTCTGCCATTTCCCATCATTAAACTGGGA
                      ____________________________________________________________
consensus CCTTCTTCTGCCATAGGCATCAAGCTCTTGGCTCTGCCATTTCCCATCATTAAACTGGGA
 
. : . : . : . : . : . :
rJMFF011K16- AGCTGTAAATGTCTGGGCATTGAAGTTTCTGTAATATGCTGTGAAGGGTGCATGGGACCA
rJMFF024A07- AGCTGTAAATGTCTGGGCATTGAAGTTTCTGTAATATGCTGTGAAGGGTGCATGGGACCA
rJMFF017H16- AGCTGTAAATGTCTGGGCATTGAAGTTTCTGTAATATGCTGTGAAGGGTGCATGGGACCA
JMFN010K06+ AGCTGTAAATGTCTGGGCATTGAAGTTTCTGTAATATGCTGTGAAGGGTGCATGGGACCA
rJMSF052N07- AGCTGTAAATGTCTGGGCATTGAAGTTTCTGTAATATGCTGTGAAGGGTGCATGGGACCA
                      ____________________________________________________________
consensus AGCTGTAAATGTCTGGGCATTGAAGTTTCTGTAATATGCTGTGAAGGGTGCATGGGACCA
 
. : . : . : . : . : . :
rJMFF011K16- ATCAGTCTTCACTAAGCCTCCCCTTGTGGCCCAGTCATCAGCATTCCACAGGCTTGAGTA
rJMFF024A07- ATCAGTCTTCACTAAGCCTCCCCTTGTGGCCCAGTCATCAGCATTCCACAGGCTTGAGTA
rJMFF017H16- ATCAGTCTTCACTAAGCCTCCCCTTGTGGCCCAGTCATCAGCATTCCACAGGCTTGAGTA
JMFN010K06+ ATCAGTCTTCACTAAGCCTCCCCTTGTGGCCCAGTCATCAGCATTCCACAGGCTTGAGTA
rJMSF052N07- ATCAGTCTTCACTAAGCCTCCCCTTGTGGCCCAGTCATCAGCATTCCACAGGCTTGAGTA
                      ____________________________________________________________
consensus ATCAGTCTTCACTAAGCCTCCCCTTGTGGCCCAGTCATCAGCATTCCACAGGCTTGAGTA
 
. : . : . : . : . : . :
rJMFF011K16- TATCTTCATAGGCTGCTTCTTGGGGAATGCCACTCCAATTGATTCACCATTCTTGAATAC
rJMFF024A07- TATCTTCATAGGCTGCTTCTTGGGGAATGCCACTCCAATTGATTCACCATTCTTGAATAC
rJMFF017H16- TATCTTCATAGGCTGCTTCTTGGGGAATGCCACTCCAATTGATTCACCATTCTTGAATAC
JMFN010K06+ TATCTTCATAGGCTGCTTCTTGGGGAATGCCACTCCAATTGATTCACCATTCTTGAATAC
rJMSF052N07- TATCTTCATAGGCTGCTTCTTGGGGAATGCCACTCCAATTGATTCACCATTCTTGAATAC
JMSF052N07+ TCATAGGCTGCTTCTTGGGGAATGCCACTCCAATTGATTCACCATTCTTGAATAC
                      ____________________________________________________________
consensus TATCTTCATAGGCTGCTTCTTGGGGAATGCCACTCCAATTGATTCACCATTCTTGAATAC
 
. : . : . : . : . : . :
rJMFF011K16- TCTTTATGGGGGTGTTATCCACCAANAAAATGATGTGTTGGGGCTTCCAAATGATGGAGA
rJMFF024A07- TC-TTATGGGGGTGTTATCCACCAAGAAAATGATGTGTTGGGGCTTCCAAATGATGGAGT
rJMFF017H16- TC-TTATGGGGGTGTTATCCACCAAGAAAANGATGTGTTGGGGCTTCCAAATGATGGAGT
JMFN010K06+ TC-TTATGGGGGTGTTATCCACCAAGAAAATGATGTGTTGGGGCTTCCAAATGATGGAGT
rJMSF052N07- TC-TTATGGGGGTGTTATCCACCAAGAAAATGATGTGTTGGGGCTTCCAAATGATGGAGT
JMFF017H16+ AAAATGATGTGTTGGGGCTTCCAAATGATGGAGT
JMSF052N07+ TC-TTATGGGGGTGTTATCCACCAAGAAAATGATGTGTTGGGGCTTCCAAATGATGGAGT
JMFF011K16+ GGGGTGTTATCCACCAAGAAAATGATGTGTTGGGGCTTCCAAATGATGGAGT
                      ____________________________________________________________
consensus TC-TTATGGGGGTGTTATCCACCAAGAAAATGATGTGTTGGGGCTTCCAAATGATGGAGT
 
. : . : . : . : . : . :
rJMFF011K16- ATGTGTGGAAGTTCTTGGTAGGGTCAAACCACAGGTANAACTGTTGCTCCCTGCCACCTT
rJMFF024A07- ATGTGTGGAAGTTCTTGGTAG
rJMFF017H16- ATGTGTGGAAGTTCTTGGTAGGGTCAAACCACAGGTAGAACTGTTGCTCCCTGCCACCTT
JMFN010K06+ ATGTGTGGAAGTTCTTGGTAGGGTCAAACCACAGGTAGAACTGTTGCTCCCTGCCACCTT
rJMSF052N07- ATGTGTGGAAGTTCTTGGTAGGGTCAAACCACAGGTAGAACTGTTGCTCCCTGCCACCTT
JMFF017H16+ ATGTGTGGAAGTTCTTGGTAGGGTCAAACCACAGGTAGAACTGTTGCTCCCTGCCACCTT
JMSF052N07+ ATGTGTGGAAGTTCTTGGTAGGGTCAAACCACAGGTAGAACTGTTGCTCCCTGCCACCTT
JMFF011K16+ ATGTGTGGAAGTTCTTGGTAGGGTCAAACCACAGGTAGAACTGTTGCTCCCTGCCACCTT
                      ____________________________________________________________
consensus ATGTGTGGAAGTTCTTGGTAGGGTCAAACCACAGGTAGAACTGTTGCTCCCTGCCACCTT
 
. : . : . : . : . : . :
rJMFF011K16- TCCCT
rJMFF017H16- TCCCTTGAGTGAAGACATTAGTGTGGAGAATGTAAGGTTGGCCAGTCACATTCCCCAAGA
JMFN010K06+ TCCCTTGAGTGAAGACATTAGTGTGGAGAATGTAAGGTTGGCCAGTCACATTCCCCAAGA
rJMSF052N07- TCCCTTGAGTGAAGACATTAGTGTGGAGAATGTAAGGTTGGCCAGTCACATTCCCCAAGA
JMFF017H16+ TCCCTTGAGTGAAGACATTAGTGTGGAGAATGTAAGGTTGGCCAGTCACATTCCCCAAGA
JMSF052N07+ TCCCTTGAGTGAAGACATTAGTGTGGAGAATGTAAGGTTGGCCAGTCACATTCCCCAAGA
JMFF011K16+ TCCC-TGAGTGAAGACATTAGTGTGGAGAATGTAAGGTTGGCCAGTCACATTCCCCAAGA
                      ____________________________________________________________
consensus TCCCTTGAGTGAAGACATTAGTGTGGAGAATGTAAGGTTGGCCAGTCACATTCCCCAAGA
 
. : . : . : . : . : . :
rJMFF017H16- NCTCAAAATCAATTTCATCATGGGGTTGGCCCTTGTGAA
JMFN010K06+ ACTCAAAATCAATTTCATCAT-GGGTTGGCCCTTGTGAAGATAGAT
rJMSF052N07- ACTCAAAATCAATTTCATCAT-GGGTTGGCCCTTGTGAAGATAGATAGTATGCTGTGACA
JMFF024A07+ ATGCTGTGACA
JMFF017H16+ ACTCAAAATCAATTTCATCAT-GGGTTGGCCCTTGTGAAGATAGATAGTATGCTGTGACA
JMSF052N07+ ACTCAAAATCAATTTCATCAT-GGGTTGGCCCTTGTGAAGATAGATAGTATGCTGTGACA
JMFF011K16+ ACTCAAAATCAATTTCATCAT-GGGTTGGCCCTTGTGAAGATAGATAGTATGCTGTGACA
                      ____________________________________________________________
consensus ACTCAAAATCAATTTCATCAT-GGGTTGGCCCTTGTGAAGATAGATAGTATGCTGTGACA
 
. : . : . : . : . : . :
rJMSF052N07- GTGCCAGCAGAGTTGCCAGCAACAAGCTTGAGCTGCATATCAATCCTGCCAAACAGATAC
JMFF024A07+ GTGCCAGCAGAGTTGCCAGCAACAAGCTTGAGCTGCATATCAATCCTGCCAAACAGATAC
JMFF017H16+ GTGCCAGCAGAGTTGCCAGCAACAAGCTTGAGCTGCATATCAATCCTGCCAAACAGATAC
JMSF052N07+ GTGCCAGCAGAGTTGCCAGCAACAAGCTTGAGCTGCATATCAATCCTGCCAAACAGATAC
JMFF011K16+ GTGCCAGCAGAGTTGCCAGCAACAAGCTTGAGCTGCATATCAATCCTGCCAAACAGATAC
                      ____________________________________________________________
consensus GTGCCAGCAGAGTTGCCAGCAACAAGCTTGAGCTGCATATCAATCCTGCCAAACAGATAC
 
. : . : . : . : . : . :
rJMSF052N07- TCTTTCTTGGACTGAAACCCAGACCCAGAAACTCTGTCTAGAGACAAGGAAAGGAGCTGC
JMFF024A07+ TCTTTCTTGGACTGAAACCCAGACCCAGAAACTCTGTCTAGAGACAAGGAAAGGAGCTGC
JMFF017H16+ TCTTTCTTGGACTGAAACCCAGACCCAGAAACTCTGTCTAGAGACAAGGAAAGGAGCTGC
JMSF052N07+ TCTTTCTTGGACTGAAACCCAGACCCAGAAACTCTGTCTAGAGACAAGGAAAGGAGCTGC
JMFF011K16+ TCTTTCTTGGACTGAAACCCAGACCCAGAAACTCTGTCTAGAGACAAGGAAAGGAGCTGC
                      ____________________________________________________________
consensus TCTTTCTTGGACTGAAACCCAGACCCAGAAACTCTGTCTAGAGACAAGGAAAGGAGCTGC
 
. : . : . : . : . : . :
rJMSF052N07- CCTTTCCCAAAAATCTTGGCCCGGTTGCCCCCCCAAGTCAAGTCAAAGTCTTGGTAGAAA
JMFF024A07+ CCTTTCCCAAAAATCTTGGCCCGGTTGCCCCCCCAAGTCAAGTCAAAGTCTTGGTAGAAA
JMFF017H16+ CCTTTCCCAAAAATCTTGGCCCGGTTGCCCCCCCAAGTCAAGTCAAAGTCTTGGTAGAAA
JMSF052N07+ CCTTTCCCAAAAATCTTGGCCCGGTTGCCCCCCCAAGTCAAGTCAAAGTCTTGGTAGAAA
JMFF011K16+ CCTTTCCCAAAAATCTTGGCCCGGTTGCCCCCCCAAGTCAAGTCAAAGTCTTGGTAGAAA
                      ____________________________________________________________
consensus CCTTTCCCAAAAATCTTGGCCCGGTTGCCCCCCCAAGTCAAGTCAAAGTCTTGGTAGAAA
 
. : . : . : . : . : . :
rJMSF052N07- TTCCCACCATGACAAACCATGCAACAACCCATCAAGATGGTAGCAAACATTACCAACAAC
JMFF024A07+ TTCCCACCATGACAAACCATGCAACAACCCATCAAGATTGTAGCAAACATTACCAACAAC
JMFF017H16+ TTCCCACCATGACAAACCATGCAACAACCCATCAAGATTGTAGCAAACATTACCAACAAC
JMSF052N07+ TTCCCACCATGACAAACCATGCAACAACCCATCAAGATTGTAGCAAACATTACCAACAAC
JMFF011K16+ TTCCCACCATGACAAACCATGCAACAACCCATCAAGATTGTAGCAAACATTACCAACAAC
                      ____________________________________________________________
consensus TTCCCACCATGACAAACCATGCAACAACCCATCAAGATTGTAGCAAACATTACCAACAAC
 
. : . : . : . : . : . :
rJMSF052N07- ATCTTTGAGCACCCAATCCTCAAAGTCCCC
JMFF024A07+ ATCTTTGAGCACCCAATCCTCAAAGTCCCCATTTCACCACAGTTAATTATGGGTTGGTGA
JMFF017H16+ ATCTTTGAGCACCCAATCCTCAAAGTCCCCATTTCACCACAGTTAATTATGGGTTGGTGA
JMSF052N07+ ATCTTTGAGCACCCAATCCTCAAAGTCCCCATTTCACCACAGTTAATTATGGGTTGGTGA
JMFF011K16+ ATCTTTGAGCACCCAATCCTCAAAGTCCCCATTTCACCACAGTTAATTATGGGTTGGTGA
                      ____________________________________________________________
consensus ATCTTTGAGCACCCAATCCTCAAAGTCCCCATTTCACCACAGTTAATTATGGGTTGGTGA
 
. : . : . : . : . : . :
JMFF024A07+ GAAATATGTAGAGAGATGAGAGGCTTTGTGGTTCTTGGCTCTGGTTTTTGAATGTGT
JMFF017H16+ GAAATATGTAGAGAGATGAGAGGCTTTGTGGTTCTTGGCTCTGGTTTTTGAATGTGT
JMSF052N07+ GAAATATGTAGAGAGATGAGAGGCTTTGTGGTTCTTGGCTCTGGTTTTTGAATGTGT
JMFF011K16+ GAAATATGTAGAGAGATGAGAGGCTTTGTGGTTCTTGGCTCTGGTTTTTGAATGTGTGAG
                      ____________________________________________________________
consensus GAAATATGTAGAGAGATGAGAGGCTTTGTGGTTCTTGGCTCTGGTTTTTGAATGTGTGAG