Previous Contig 000610:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011J15Sequence519000610 (5)pir|S51946|S519461e-05pyruvate kinase (EC 2.7.1.40) A, chloroplast - common tobacco695010755 (5)pir|S51946|S519461e-97pyruvate kinase (EC 2.7.1.40) A, chloroplast - common tobacco
JMFF045B21Sequence637000610 (5)pir|S51946|S519467e-27pyruvate kinase (EC 2.7.1.40) A, chloroplast - common tobacco621010755 (5)pir|S51946|S519464e-81pyruvate kinase (EC 2.7.1.40) A, chloroplast - common tobacco
JMFF047J22Sequence558000610 (5)pir|S51946|S519462e-29pyruvate kinase (EC 2.7.1.40) A, chloroplast - common tobacco522010755 (5)pir|S51946|S519468e-66pyruvate kinase (EC 2.7.1.40) A, chloroplast - common tobacco
JMFF048B03Sequence391000610 (5)pir|S51946|S519462e-08pyruvate kinase (EC 2.7.1.40) A, chloroplast - common tobacco253010755 (5)gb:AY085149_15702303e-17Arabidopsis thaliana clone 13351 mRNA, complete sequence.
JMSF008D15Sequence242000610 (5)774010755 (5)pir|S51946|S51946e-115pyruvate kinase (EC 2.7.1.40) A, chloroplast - common tobacco

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047J22+ AGCCACGTTCATCCCGCCGACGGCCAACGCCTCGAGCTGCTCGAACCCGCAGG
JMFF045B21+ ATCCCGCCGACGGCCAACGCCTCGAGCTGCTCGAACCCGCAGG
                      ____________________________________________________________
consensus AGCCACGTTCATCCCGCCGACGGCCAACGCCTCGAGCTGCTCGAACCCGCAGG
 
. : . : . : . : . : . :
JMFF047J22+ TGGCGGGCCCAATGGTGCACACCAGCTTAGTCCGCCTCGTGCTCCGGAACCCATTCTCTT
JMFF045B21+ TGGCGGGCCCAATGGTGCACACCAGCTTAGTCCGCCTCGTGCTCCGGAACCCATTCTCTT
                      ____________________________________________________________
consensus TGGCGGGCCCAATGGTGCACACCAGCTTAGTCCGCCTCGTGCTCCGGAACCCATTCTCTT
 
. : . : . : . : . : . :
JMFF047J22+ TCAGCTCCGCCTCCGTCACCGCGTCCACGTCAATCGCCGCCAGCTCCTGCGTCGCAGCGG
JMFF045B21+ TCAGCTCCGCCTCCGTCACCGCGTCCACGTCAATCGCCGCCAGCTCNTGCGTCGCAGCGG
JMFF048B03+ CGG
JMFF011J15+ CGTCCACGTCAATCGCCGCCAGCTCCTGCGTCGCAGCGG
                      ____________________________________________________________
consensus TCAGCTCCGCCTCCGTCACCGCGTCCACGTCAATCGCCGCCAGCTCCTGCGTCGCAGCGG
 
. : . : . : . : . : . :
JMFF047J22+ ATACCGCCCCCGCCCCGCCGGAGCCATTATCCGAGACCAGCACACGGGAGGACCGCAAAT
JMFF045B21+ ATACCGCCCCCGCCCCGCCGGAGCCATTATCCGAGACCAGCACACGGGAGGACCGCAAAT
JMFF048B03+ ATACCGCCCCCGCCCCGCCGGAGCCATTATCCGAGACCAGCACACGGGAGGACCGCAAAT
JMFF011J15+ ATACCGCCCCCGCCCCGCCGGAGCCATTATCCGAGACCAGCACACGGGAGGACCGCAAAT
                      ____________________________________________________________
consensus ATACCGCCCCCGCCCCGCCGGAGCCATTATCCGAGACCAGCACACGGGAGGACCGCAAAT
 
. : . : . : . : . : . :
JMFF047J22+ CGAGATCTGAATTCGAAGCTCTGACGACGAACGACCGCGCCGGAGCCTTCGCCGGGACCC
JMFF045B21+ CGAGATCTGAATTCGAAGCTCTGACGACGAACGACCGCGCCGGAGCCTTCGCCGGGACCC
JMFF048B03+ CGAGATCTGAATTCGAAGCTCTGACGACGAACGACCGCGCCGGAGCCTTCGCCGGGACCC
JMSF008D15+ GACGACGAACGACCGCGCCGGAGCNTTCGCCGGGACCC
JMFF011J15+ CGAGATCTGAATTCGAAGCTCTGACGACGAACGACCGCGCCGGAGCCTTCGCCGGGACCC
                      ____________________________________________________________
consensus CGAGATCTGAATTCGAAGCTCTGACGACGAACGACCGCGCCGGAGCCTTCGCCGGGACCC
 
. : . : . : . : . : . :
JMFF047J22+ GGAACCCCCGGGCCGGAGCAAACGACAGAGAAGGCTTGGAAACTGCAAATCCCGGCAGCG
JMFF045B21+ GGAACCCCCGGGCCGGAGCAAACGACAGAGAAGGCTTGGAAACTGCAAATCCCGGCAGCG
JMFF048B03+ GGAACCCCCGGGCCGGAGCAAACGACAGAGAAGGCTTGGAAACTGCAAATCCCGGCAGCG
JMSF008D15+ GGAACCCCCGGGCCGGAGCAAACGACAGAGAAGGCTTGGAAACTGCAAATCCCGGCAGCG
JMFF011J15+ GGAACCCCCGGGCCGGAGCAAACGACAGAGAAGGCTTGGAAACTGCAAATCCCGGCAGCG
                      ____________________________________________________________
consensus GGAACCCCCGGGCCGGAGCAAACGACAGAGAAGGCTTGGAAACTGCAAATCCCGGCAGCG
 
. : . : . : . : . : . :
JMFF047J22+ ATGCAGAAGAGGAGGAGACAAAGAAGTTGAGAGCTCGCGACATTTTGCCCGGAAACCTCA
JMFF045B21+ ATGCAGAAGAGGAGGAGACAAAGAAGTTGAGAGCTCGCGACATTTTGCCCGGAAACCTCA
JMFF048B03+ ATGCAGAAGAGGAGGAGACAAAGAAGTTGAGAGCTCGCGACATTTTGCCCGGAAACCTCA
JMSF008D15+ ATGCAGAAGAGGAGGAGACAAAGAAGTTGAGAGCTCGCGACATTTTGCCCGGAAACCTCA
JMFF011J15+ ATGCAGAAGAGGAGGAGACAAAGAAGTTGAGAGCTCGCGACATTTTGCCCGGAAACCTCA
                      ____________________________________________________________
consensus ATGCAGAAGAGGAGGAGACAAAGAAGTTGAGAGCTCGCGACATTTTGCCCGGAAACCTCA
 
. : . : . : . : . : . :
JMFF047J22+ ACAACTACCGGTTATCCGGCGGAGTATCTGAGAAACCCAGAAATTGAGCCAATGATGGGA
JMFF045B21+ ACAACTACCGGTTATCCGGCGGAGTATCTGAGAAACCCAGAAATTGAGCCAATGATGGGA
JMFF048B03+ ACAACTACCGGTTATCCGGCGGAGTATCTGAGAAACCCAGAAATTGAGCCAATGATGGGA
JMSF008D15+ ACAACTACCGGTTATCCGGCGGAGTATCTGAGAAACCCAGAAATTGAGCCAATGATGGGA
JMFF011J15+ ACAACTACCGGTTATCCGGCGGAGTATCTGAGAAACCCAGAAATTGAGCCAATGATGGGA
                      ____________________________________________________________
consensus ACAACTACCGGTTATCCGGCGGAGTATCTGAGAAACCCAGAAATTGAGCCAATGATGGGA
 
. : . : . : . : . : . :
JMFF047J22+ GTTGAAACGACAGAGAAAAATGCGGGGCTGAGATGGCGAACTCAAGGCAAGAAAAAGGGG
JMFF045B21+ GTTGAAACGACAGAGAAAAATGCGGGGCTGAGATGGCGAACTCAAGGCAAGAAAAAGGGG
JMFF048B03+ GTTGAAACGACAGAGAAAAATGCGGGGCTGAGATGGCGAACTCAAGGCAAGAAAAAGGGG
JMSF008D15+ GTTGAAACGACAGAGAAAAATGC
JMFF011J15+ GTTGAAACGACAGAGAAAAATGCGGGGCTGAGATGGCGAACTCAAGGCAAGAAAAAGGGG
                      ____________________________________________________________
consensus GTTGAAACGACAGAGAAAAATGCGGGGCTGAGATGGCGAACTCAAGGCAAGAAAAAGGGG
 
. : . : . : . : . : . :
JMFF047J22+ GGGGACGTGAGTGTCAATGTTC
JMFF045B21+ GGGGACGTGAGTGTCAATGTTCGACAATTTTGAGGTTCTTCTTCCCCAACCAGCGGAGTA
JMFF048B03+ GGGGACGTGAGTGTCAATGTTC
JMFF011J15+ GGGGACGTGAGTGTCAATGTTCGACAATTTTGAGGTTCTTCTTCCCCAACCAGCGGAGTA
                      ____________________________________________________________
consensus GGGGACGTGAGTGTCAATGTTCGACAATTTTGAGGTTCTTCTTCCCCAACCAGCGGAGTA
 
. : . : . : . : . : . :
JMFF045B21+ TACTATGCTTTCAGCGACATTGATAGTTGATACTGTTGGGAATGTGATGGACAC
JMFF011J15+ TACTATGCTTTCAGCGACATTGATAGTTGATACTGTTGGGAATGTGATGGACACCGATGA
                      ____________________________________________________________
consensus TACTATGCTTTCAGCGACATTGATAGTTGATACTGTTGGGAATGTGATGGACACCGATGA