Previous Contig 000607:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011I07Sequence521000607 (2)sp|Q43062|PME_PRUPE1e-04Pectinesterase PPE8B precursor (EC 3.1.1.11) (Pectin methylesterase) (PE).>gb:PP399006411 (4)gb:AY043232_15609825e-48Vitis vinifera pectin methylesterase mRNA, complete cds.
JMFS060H07Sequence626000607 (2)sp|Q43062|PME_PRUPE8e-19Pectinesterase PPE8B precursor (EC 3.1.1.11) (Pectin methylesterase) (PE).>gb:PP

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS060H07+ CCAGACCATCGGTGCCGTCGAAGCCTTCAATGCAGGTGTCTTG
                      ____________________________________________________________
consensus CCAGACCATCGGTGCCGTCGAAGCCTTCAATGCAGGTGTCTTG
 
. : . : . : . : . : . :
JMFS060H07+ ATTGATCATCGCNCCGCTCAACCACGCCCTTAAATCAGCACTCAGATTGCCCGTGCTATT
                      ____________________________________________________________
consensus ATTGATCATCGCNCCGCTCAACCACGCCCTTAAATCAGCACTCAGATTGCCCGTGCTATT
 
. : . : . : . : . : . :
JMFS060H07+ CTTCCTTTTACCATTAGGATTCTGAGATGCAGAGA-GGGTGGAGGAGAGTTCATCGGCAG
JMFF011I07+ TTCTGAGATGCAGAGAGGGGTGGAGGAGAGTTCATCGGCAG
                      ____________________________________________________________
consensus CTTCCTTTTACCATTAGGATTCTGAGATGCAGAGAGGGGTGGAGGAGAGTTCATCGGCAG
 
. : . : . : . : . : . :
JMFS060H07+ AGAGGTCAAGCAAATCAAGGCAGTCAGAGACGGCATTAGAAAGCCTAAAATCACCAAAAA
JMFF011I07+ AGAGGTCAAGCAAATCAAGGCAGTCAGAGACGGCATTAGAAAGCCTAAAATCACCAAAAA
                      ____________________________________________________________
consensus AGAGGTCAAGCAAATCAAGGCAGTCAGAGACGGCATTAGAAAGCCTAAAATCACCAAAAA
 
. : . : . : . : . : . :
JMFS060H07+ CATTGCCAACTTTTGCCACCACAGACGTGACCTGCTGGACAACGTCGATGGTGGTCTTCA
JMFF011I07+ CATTGCCAACTTTTGCCACCACAGACGTGACCTGCTGGACAACGTCGATGGTGGTCTTCA
                      ____________________________________________________________
consensus CATTGCCAACTTTTGCCACCACAGACGTGACCTGCTGGACAACGTCGATGGTGGTCTTCA
 
. : . : . : . : . : . :
JMFS060H07+ AAGACCCCACGAAATCCGCCGCAGAAACCTTCAAAACCTCCGCCGCCGGCGGATCAAACC
JMFF011I07+ AAGACCCCACGAAATCCGCCGCAGAAACCTTCAAAACCTCCGCCGCCGGCGGATCAAACC
                      ____________________________________________________________
consensus AAGACCCCACGAAATCCGCCGCAGAAACCTTCAAAACCTCCGCCGCCGGCGGATCAAACC
 
. : . : . : . : . : . :
JMFS060H07+ CCACTCCGCCGCCGCCGGACAGATTACACAAACACAAGATTACCAGAAACAAGCAGGCAG
JMFF011I07+ CCACTCCGCCGCCGCCGGACAGATTACACAAACACAAGATTACCAGAAACAAGCAGGCAG
                      ____________________________________________________________
consensus CCACTCCGCCGCCGCCGGACAGATTACACAAACACAAGATTACCAGAAACAAGCAGGCAG
 
. : . : . : . : . : . :
JMFS060H07+ GGGACAAGGAATGAGCCATTTCAATTCCAATAATAAATTTTAGCACAAAACGCAGATAGA
JMFF011I07+ GGGACAAGGAATGAGCCATTTCAATTCCAATAATAAATTTTAGCACAAAACGCAGATAGA
                      ____________________________________________________________
consensus GGGACAAGGAATGAGCCATTTCAATTCCAATAATAAATTTTAGCACAAAACGCAGATAGA
 
. : . : . : . : . : . :
JMFS060H07+ CCGAAACGGAGCACTTAAAGTGATGAAAGAAGTCATGATTTCGAAGCGGCATTCATTGCT
JMFF011I07+ CCGAAACGGAGCACTTAAAGTGATGAAAGAAGTCATGATTTCGAAGCGGCATTCATTGCT
                      ____________________________________________________________
consensus CCGAAACGGAGCACTTAAAGTGATGAAAGAAGTCATGATTTCGAAGCGGCATTCATTGCT
 
. : . : . : . : . : . :
JMFS060H07+ GTTGTCAGGAAGCAGAAGCACAAGGCCGGTGTTCAAACGTGGCAGCTACAATAGACAGGG
JMFF011I07+ GTTGTCAGGAAGCAGAAGCACAAGGCCGGTGTTCAAACGTGGCAGCTACAATAGACAGGG
                      ____________________________________________________________
consensus GTTGTCAGGAAGCAGAAGCACAAGGCCGGTGTTCAAACGTGGCAGCTACAATAGACAGGG
 
. : . : . : . : . : . :
JMFS060H07+ CCAACATGCACGGTTTGGTGAGTGTAATTACTACGTTTGACTTC
JMFF011I07+ CCAACATGCACGGTTTGGTGAGTGTAATTACTACGTTTGACTTCTCGCTCACAACATCGT
                      ____________________________________________________________
consensus CCAACATGCACGGTTTGGTGAGTGTAATTACTACGTTTGACTTCTCGCTCACAACATCGT