Previous Contig 000606:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011I06Sequence790000606 (12)gb:AJ844617_1814726e-123Plantago major mRNA for polyubiquitin (ubq3 gene).920010265 (10)gb:AMUBIQMRP_1819337e-108A.majus mRNA for ubiquitin (partial).
JMFF020M18Sequence772000606 (12)gb:ZMU29159_1732118e-110Zea mays clone MubG1 ubiquitin gene, complete cds.910010265 (10)gb:ATU84969_1557346e-103Arabidopsis thaliana ubiquitin (UBQ11) gene, complete cds.
JMFF022D06Sequence813000606 (12)gb:PVU77940_17030631e-66Phaseolus vulgaris polyubiquitin mRNA, partial cds.801021159gb:AMUBIQMRP_18193372e-61A.majus mRNA for ubiquitin (partial).
JMFF022E04Sequence763000606 (12)gb:PSUBIQU_1702575e-104P.sylvestris mRNA for polyubiquitin.
JMFF023O07Sequence671000606 (12)gb:PSUBIQU_17025751e-72P.sylvestris mRNA for polyubiquitin.
JMFF024A09Sequence765000606 (12)gb:AMUBIQMRP_18193374e-96A.majus mRNA for ubiquitin (partial).679010265 (10)gb:ATHUBQ10R_15534617e-59Arabidopsis thaliana polyubiquitin (ubq10) mRNA, complete cds.>gb:AY139999_15824
JMFF035M14Sequence776000606 (12)gb:AK056939_19118671e-99Homo sapiens cDNA FLJ32377 fis, clone SKMUS1000014, highly similar to Polyubiqui851010265 (10)gb:AY117055_15791321e-99Gossypium herbaceum putative polyubiquitin gene, partial cds.>gb:AY117056_157913
JMFF042O14Sequence652000606 (12)gb:AMUBIQMRP_1819337e-100A.majus mRNA for ubiquitin (partial).579010265 (10)gb:AMUBIQMRP_18193373e-50A.majus mRNA for ubiquitin (partial).
JMFF045C12Sequence614000606 (12)gb:AMUBIQMRP_18193379e-92A.majus mRNA for ubiquitin (partial).604010265 (10)gb:AMUBIQMRP_18193373e-71A.majus mRNA for ubiquitin (partial).
JMFF051B10Sequence571000606 (12)gb:AMUBIQMRP_18193375e-84A.majus mRNA for ubiquitin (partial).513010265 (10)gb:AMUBIQMRP_18193372e-45A.majus mRNA for ubiquitin (partial).
JMFS147D04Sequence606000606 (12)gb:AMUBIQMRP_18193371e-94A.majus mRNA for ubiquitin (partial).
JMSF040E04Sequence619000606 (12)gb:AMUBIQMRP_18193374e-84A.majus mRNA for ubiquitin (partial).1047010265 (10)gb:AMUBIQMRP_1819337e-135A.majus mRNA for ubiquitin (partial).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011I06+ TTTTCACAAAGATNTGCATCCCC
                      ____________________________________________________________
consensus TTTTCACAAAGATNTGCATCCCC
 
. : . : . : . : . : . :
JMFF020M18+ GACTCCTTTNGGATATTGTAGTCTGCAA-G
JMFF035M14+ GGGTAGACTCCTTNTGGATATNGTAGTCTGCAN-G
JMFF022E04+ TGGATATTGTANTCTGCAAGG
JMFF011I06+ CCNCGCAGACGAAGGACAAGGTGGAGGGTAGACTCCTTCTGGATATNGTAGTCTGCAA-G
                      ____________________________________________________________
consensus CCNCGCAGACGAAGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTGTAGTCTGCAA-G
 
. : . : . : . : . : . :
JMFF020M18+ AGTGCGT-CCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGA-GGA
JMFF035M14+ AGTGCGTCCCATCATCAAGCTGCTTTCCAGC-AAAATCAGTCTCTGTTGATCTGGA-GGA
JMFF022E04+ AGTGCGT-CCATCATCAAGNTGCTTNCCAGCAAAAATCAGTCTCTGTTGATCNGGAGGGA
JMFF042O14+ GA-GGA
JMFF024A09+ TGGA-GGA
JMFF011I06+ AGTGCGT-CCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGA-GGA
                      ____________________________________________________________
consensus AGTGCGT-CCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGA-GGA
 
. : . : . : . : . : . :
JMFF020M18+ ATT-CCTTCCNTTATCTGGAATCTTAGCCTTTACATNGTCAATGGTATCTGAGCTCTCAA
JMFF035M14+ ATTCCCTTCCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAA
JMFS147D04+ TAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAA
JMFF022E04+ ATT-CCTTCC-TTATCTGGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAA
JMFF042O14+ ATT-CCTTCC-TTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAA
JMFF024A09+ ATT-CCTTCCTTTATCTGGAATCTTAGCCTTTCCATNGTCAATGGTATNTGAGCTCTCAA
JMFF045C12+ TCAATGGTATCTGAGCTCTCAA
JMSF040E04+ ACATTGTCAATGGTATCTGAGCTCTCAA
JMFF011I06+ ATT-CCTTCC-TTATCTTGAATCTTAGCCTTTACATNGTCAATGGTATCTGAGCTCTCAA
                      ____________________________________________________________
consensus ATT-CCTTCCTTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAA
 
. : . : . : . : . : . :
JMFF020M18+ CCTCAAGTGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCACCACG
JMFF035M14+ CCTCAAGTGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCACCACG
JMFS147D04+ CCTCAAGTGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCACCACG
JMFF022E04+ CCTCAAGTGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCACCACG
JMFF042O14+ CCTCAAGTGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCACCACG
JMFF024A09+ CCTCAAGTGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCNCCACG
JMFF045C12+ CCTCAAGTGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCACCACG
JMFF051B10+ GCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCACCACG
JMSF040E04+ CCTCAAGCGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATNT-GCAT-ACCACCACG
JMFF023O07+ CCAGTTAGAGTTTTCNCAAAGATCT-GCATACCCACCACG
JMFF022D06+ GCCAGTTAGAGTTTTCACAAAGATNTGGCAT-CCCCCCACG
JMFF011I06+ CCTCAAGTGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCACCACG
                      ____________________________________________________________
consensus CCTCAAGTGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCT-GCAT-ACCACCACG
 
. : . : . : . : . : . :
JMFF020M18+ CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATTGTAGTCTGCAAGA
JMFF035M14+ CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATTGTAGTCTGCAAGA
JMFS147D04+ CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATTGTAGTCTGCAAGA
JMFF022E04+ CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATTGTAGTCTGCAAGA
JMFF042O14+ CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATTGTAGTCTGCAAGA
JMFF024A09+ CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATTGTAGTCTGCAAGA
JMFF045C12+ CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATTGTAGTCTGCAAGA
JMFF051B10+ CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATNGTAGTCTGCAAGA
JMSF040E04+ CNGNCG-AAGGACAN-GGTGGA-GGGTAGACT-CCTTCN-GGATATTGTAGTNTGCAAGA
JMFF023O07+ CAGACGAAAGGANCAAGGTGGAGGGGTAGACTCCCTTCT-GGATATTGTAGTCTGCAAGA
JMFF022D06+ CAGACG-AAGGACAAGGGTGGAGGGGTAGACT-CCTTCTGGGATATNGTAGTCTGCAAGA
JMFF011I06+ CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATTGTAGTCTGCAAGA
                      ____________________________________________________________
consensus CAGACG-AAGGACAA-GGTGGA-GGGTAGACT-CCTTCT-GGATATTGTAGTCTGCAAGA
 
. : . : . : . : . : . :
JMFF020M18+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMFF035M14+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMFS147D04+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMFF022E04+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMFF042O14+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMFF024A09+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMFF045C12+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMFF051B10+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMSF040E04+ GTGCGTCCATCATCNAGNTGCTTTCCAGCAAAAATCAGTCTNTGTTGATCTGGAGGAATT
JMFF023O07+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMFF022D06+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
JMFF011I06+ GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
                      ____________________________________________________________
consensus GTGCGTCCATCATCAAGCTGCTTTCCAGCAAAAATCAGTCTCTGTTGATCTGGAGGAATT
 
. : . : . : . : . : . :
JMFF020M18+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFF035M14+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFS147D04+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFF022E04+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFF042O14+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFF024A09+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFF045C12+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFF051B10+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMSF040E04+ CCTTCCTTATCTNGAATCTTAGCCTNTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFF023O07+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFF022D06+ CC-TCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
JMFF011I06+ CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
                      ____________________________________________________________
consensus CCTTCCTTATCTTGAATCTTAGCCTTTACATTGTCAATGGTATCTGAGCTCTCAACCTCA
 
. : . : . : . : . : . :
JMFF020M18+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFF035M14+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFS147D04+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFF022E04+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFF042O14+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFF024A09+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFF045C12+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFF051B10+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMSF040E04+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFF023O07+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFF022D06+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
JMFF011I06+ AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
                      ____________________________________________________________
consensus AGGGTGATGGTCTTGCCAGTTAGAGTTTTCACAAAGATCTGCATACCACCACGCAGACGA
 
. : . : . : . : . : . :
JMFF020M18+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFF035M14+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFS147D04+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFF022E04+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFF042O14+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFF024A09+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFF045C12+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFF051B10+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMSF040E04+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFF023O07+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFF022D06+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
JMFF011I06+ AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
                      ____________________________________________________________
consensus AGGACAAGGTGGAGGGTAGACTCCTTTTGGATATTATAGTCTGCAAGTGTACGGCCATCT
 
. : . : . : . : . : . :
JMFF020M18+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMFF035M14+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMFS147D04+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMFF022E04+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMFF042O14+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMFF024A09+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMFF045C12+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMFF051B10+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMSF040E04+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCNGGAGGAATTCCTTCCTTATCT
JMFF023O07+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMFF022D06+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
JMFF011I06+ TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
                      ____________________________________________________________
consensus TCAAGCTGCTTTCCTGCAAAAATCAGTCGCTGTTGATCTGGAGGAATTCCTTCCTTATCT
 
. : . : . : . : . : . :
JMFF020M18+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMFF035M14+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMFS147D04+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMFF022E04+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMFF042O14+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMFF024A09+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMFF045C12+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMFF051B10+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMSF040E04+ NGGATNTTTGCCTNAACATTATCAATGGTATNGGAACTCTCAACCTCAAGAGTAATAGTC
JMFF023O07+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMFF022D06+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
JMFF011I06+ TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
                      ____________________________________________________________
consensus TGGATTTTTGCCTTAACATTATCAATGGTATCGGAACTCTCAACCTCAAGAGTAATAGTC
 
. : . : . : . : . : . :
JMFF020M18+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFF035M14+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFS147D04+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFF022E04+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFF042O14+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFF024A09+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFF045C12+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFF051B10+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMSF040E04+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFF023O07+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFF022D06+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
JMFF011I06+ TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
                      ____________________________________________________________
consensus TTTCCAGTAAGAGTCTTTACAAAGATCTGCATCTTGAGAGAGGCTTTAGGTGTCGAGCGA
 
. : . : . : . : . : . :
JMFF020M18+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGAC
JMFF035M14+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGAC
JMFS147D04+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGAT
JMFF022E04+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGAC
JMFF042O14+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGAC
JMFF024A09+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGAC
JMFF045C12+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGAC
JMFF051B10+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGAC
JMSF040E04+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGAGTTGATCTGAAGAAACAGGAC
JMFF023O07+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGAC
JMFF022D06+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGAC
JMFF011I06+ TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGACAAT
                      ____________________________________________________________
consensus TGGAGGGATATGGAGAGAGAGATTTGTCGCGATTGA-TTGATTTGAAGAAACAGGACAAT