Previous Contig 000604:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011G23Sequence465000604 (5)533020898gb:AC005168_15322491e-36Arabidopsis thaliana chromosome 2 clone F12C20 map B68, complete sequence.>gb:AF
JMFF020N19Sequence581000604 (5)
JMFN003L12Sequence627000604 (5)gb:AC005168_15322493e-28Arabidopsis thaliana chromosome 2 clone F12C20 map B68, complete sequence.>gb:AF
JMFS125B04Sequence572000604 (5)
JMFS125C04Sequence437000604 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN003L12+ CACGCCTGCAATGTTNTG
                      ____________________________________________________________
consensus CACGCCTGCAATGTTNTG
 
. : . : . : . : . : . :
JMFN003L12+ AATTGCTTGAATTACATCCTNTGCATCAGCAAGCTGTGGTACCCACTTCGGTGACACAAA
                      ____________________________________________________________
consensus AATTGCTTGAATTACATCCTNTGCATCAGCAAGCTGTGGTACCCACTTCGGTGACACAAA
 
. : . : . : . : . : . :
JMFN003L12+ ACTAGTAGCTTCGACGACTTCCAGCCCCGCAGAAACAAGCATTTGTATTAGTTCAACTTT
                      ____________________________________________________________
consensus ACTAGTAGCTTCGACGACTTCCAGCCCCGCAGAAACAAGCATTTGTATTAGTTCAACTTT
 
. : . : . : . : . : . :
JMFN003L12+ CACACTTGTAGATATGATCTCCTTTTCATTTTGCAACCCATCTCTTGGACCTACTTCTAC
                      ____________________________________________________________
consensus CACACTTGTAGATATGATCTCCTTTTCATTTTGCAACCCATCTCTTGGACCTACTTCTAC
 
. : . : . : . : . : . :
JMFN003L12+ TATCCTCACAAATTCAGGCAAAGATCCCAATACCTTATTTAAGCCTACACCATGTCGTGG
                      ____________________________________________________________
consensus TATCCTCACAAATTCAGGCAAAGATCCCAATACCTTATTTAAGCCTACACCATGTCGTGG
 
. : . : . : . : . : . :
JMFN003L12+ ATTCAGTTGTGTGCTATAACAATGATGCAACATATGGAAAGCATTATGTGTGGTTCCAGT
                      ____________________________________________________________
consensus ATTCAGTTGTGTGCTATAACAATGATGCAACATATGGAAAGCATTATGTGTGGTTCCAGT
 
. : . : . : . : . : . :
JMFN003L12+ AACACTAGTTTCTCGGGTAAAGGCAGGATTATGTGAAACTCTATTCGTTTGCCTTTGCCA
                      ____________________________________________________________
consensus AACACTAGTTTCTCGGGTAAAGGCAGGATTATGTGAAACTCTATTCGTTTGCCTTTGCCA
 
. : . : . : . : . : . :
JMFN003L12+ TAGATATACTCTTCCATTGTCTTCCTCCCTGTCCATTTTACTCGAAGAGAACCGCTTCCC
JMFS125C04+ TCCATTTTACTCGAAGAGAACCGCTTCCC
JMFS125B04+ TCCATTTTACTCGAAGAGAACCGCTTCCC
JMFF020N19+ TCCATTTTACTCGAAGAGAACCGCTTCCC
JMFF011G23+ TCCATTTTACTCGAAGAGAACCGCTTCCC
                      ____________________________________________________________
consensus TAGATATACTCTTCCATTGTCTTCCTCCCTGTCCATTTTACTCGAAGAGAACCGCTTCCC
 
. : . : . : . : . : . :
JMFN003L12+ -TTGTTCACCCTTGAAATTTTGGAGTTCCATTTCAGGAACACTGCCTAGAATATCATTAC
JMFS125C04+ -TTGTTCACCCTTGAAATTTTGGAGTTCCATTTCAGGAACACTGCCTAGAATATCATTAC
JMFS125B04+ -TTGTTCACCCTTGAAATTTTGGAGTTCCATTTCAGGAACACTGCCTAGAATATCATTAC
JMFF020N19+ TTTGTTCACCCTTGAAATTTTGGAGTTCCATTTCAGGAACACTGCCTAGAATATCATTAC
JMFF011G23+ -TTGTTCACCCTTGAAATTTTGGAGTTCCATTTCAGGAACACTGCCTAGAATATCATTAC
                      ____________________________________________________________
consensus -TTGTTCACCCTTGAAATTTTGGAGTTCCATTTCAGGAACACTGCCTAGAATATCATTAC
 
. : . : . : . : . : . :
JMFN003L12+ CAAATACACTGCAAGCACCAAATCTCAACCTCGAAAATTTCCTGACAGCCTTATGTGATA
JMFS125C04+ CAAATACACTGCAAGCACCAAATCTCAACCTCGAAAATTTCCTGACAGCCTTATGTGATA
JMFS125B04+ CAAATACACTGCAAGCACCAAATCTCAACCTCGAAAATTTCCTGACAGCCTTATGTGATA
JMFF020N19+ CAAATACACTGCAAGCACCAAATCTCAACCTCGAAAATTTCCTGACAGCCTTATGTGATA
JMFF011G23+ CAAATACACTGCAAGCACCAAATCTCAACCTCGAAAATTTCCTGACAGCCTTATGTGATA
                      ____________________________________________________________
consensus CAAATACACTGCAAGCACCAAATCTCAACCTCGAAAATTTCCTGACAGCCTTATGTGATA
 
. : . : . : . : . : . :
JMFN003L12+ ACATTGGATCACAACTTAATGTGTTGAAACAAACAACAGCTTATTCCAGATGTTTAC
JMFS125C04+ ACATTGGATCACAACTTAATGTGTTGAAACAAACAGCAGCTTATTCCAGATGTTTACCTT
JMFS125B04+ ACATTGGATCACAACTTAATGTGTTGAAACAAACAACAGCTTATTCCAGATGTTTACCTT
JMFF020N19+ ACATTGGATCACAACTTAATGTGTTGAAACAAACAACAGCTTATTCCAGATGTTTACCTT
JMFF011G23+ ACATTGGATCACAACTTAATGTGTTGAAACAAACAACAGCTTATTCCAGATGTTTACCTT
                      ____________________________________________________________
consensus ACATTGGATCACAACTTAATGTGTTGAAACAAACAACAGCTTATTCCAGATGTTTACCTT
 
. : . : . : . : . : . :
JMFS125C04+ CAAAGCTTATCTGTTCTGAGATTCAGTAGAGCTACGGAGCAGAAAAAACTCAAAGTTTAG
JMFS125B04+ CAAAGCTTATCTGTTCTGAGATTCAGTAGAGCTACGGAGCAGAAAAAACTCAAAGTTTAG
JMFF020N19+ CAAAGCTTATCTGTTCTGAGATTCAGTAGAGCTACGGAGCAGAAAAAACTCAAAGTTTAG
JMFF011G23+ CAAAGCTTATCTGTTCTGAGATTCAGTAGAGCTACGGAGCAGAAAAAACTCAAAGTTTAG
                      ____________________________________________________________
consensus CAAAGCTTATCTGTTCTGAGATTCAGTAGAGCTACGGAGCAGAAAAAACTCAAAGTTTAG
 
. : . : . : . : . : . :
JMFS125C04+ CACAACCAGCTGAAAATATTGCAATTTTATGGAGAAATTTGCGAACAAATTCATAAGCGT
JMFS125B04+ CACAACCAGCTGAAAATATTGCAATTTTATGGAGAAATTTGCGAACAAATTCATAAGCGT
JMFF020N19+ CACAACCAGCTGAAAATATTGCAATTTTATGGAGAAATTTGCGAACAAATTCATAAGCGT
JMFF011G23+ CACAACCAGCTGACAATATTGCAATTTTATGGAGAAATTTGCGAACAAATTCATAAGCGT
                      ____________________________________________________________
consensus CACAACCAGCTGAAAATATTGCAATTTTATGGAGAAATTTGCGAACAAATTCATAAGCGT
 
. : . : . : . : . : . :
JMFS125C04+ GTTTCAGTTTTCGGGTTCAAAAAAATTTGGACCATTTCTCGATTTGTGCGTGTCATCCTT
JMFS125B04+ GTTTCAGTTTTCGGGTTCAAAAAAATTTGGACCATTTCTCGATTTGTGCGTGTCATCCTT
JMFF020N19+ GTTTCAGTTTTCGGGTTCAAAAAAATTTGGACCATTTCTCGATTTGTGCGTGTCATCCTT
JMFF011G23+ GTTTCAGTTTTCGGGTTCAAAAAAATTTGGACCATTTCTCGATTTGTGCGTGTCATCCTT
                      ____________________________________________________________
consensus GTTTCAGTTTTCGGGTTCAAAAAAATTTGGACCATTTCTCGATTTGTGCGTGTCATCCTT
 
. : . : . : . : . : . :
JMFS125C04+ GCGCAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTATCGGA
JMFS125B04+ GCGCAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTATCGGA
JMFF020N19+ GCGCAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTATCGGATGTCTCCGAAG
JMFF011G23+ GCGCAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTATCGGATGTCTCCGAAGA
                      ____________________________________________________________
consensus GCGCAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTATCGGATGTCTCCGAAGA