Previous Contig 000600:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011G07Sequence328000600 (3)gb:AB023041_15154664e-11Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPE11.572008708 (3)gb:AY035031_15598092e-57Arabidopsis thaliana unknown protein (At3g26100) mRNA, complete cds.>gb:AY059105
JMFF020O02Sequence427000600 (3)gb:AB023041_15154666e-28Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPE11.634008708 (3)gb:AY035031_15598093e-71Arabidopsis thaliana unknown protein (At3g26100) mRNA, complete cds.>gb:AY059105
JMFS147F02Sequence607000600 (3)gb:AB023041_15154661e-20Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPE11.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS147F02+ AACGAACAAGTGGCCTGCAAAACCGCATTATATAATTCAAA
                      ____________________________________________________________
consensus AACGAACAAGTGGCCTGCAAAACCGCATTATATAATTCAAA
 
. : . : . : . : . : . :
JMFS147F02+ TCAGCAGCAACATCAATTCTCAAGCCAAACATAGTTCGCTTCGAAGATACTAAAAGGTAG
                      ____________________________________________________________
consensus TCAGCAGCAACATCAATTCTCAAGCCAAACATAGTTCGCTTCGAAGATACTAAAAGGTAG
 
. : . : . : . : . : . :
JMFS147F02+ AAACACATGCCTCTAGTATCGCGAGGTCCTGTGGATCCAAATTACACCCAGTAAGGACAT
                      ____________________________________________________________
consensus AAACACATGCCTCTAGTATCGCGAGGTCCTGTGGATCCAAATTACACCCAGTAAGGACAT
 
. : . : . : . : . : . :
JMFS147F02+ GAAGGACAATGGAGGGGTTGGCAGACAACGGGAACTCCCCGGGACGAGCGTTTCCAAGAC
                      ____________________________________________________________
consensus GAAGGACAATGGAGGGGTTGGCAGACAACGGGAACTCCCCGGGACGAGCGTTTCCAAGAC
 
. : . : . : . : . : . :
JMFS147F02+ AATGCCTCTGTTGCTTTTGAAACGTGGGCACGGGAGAGGTGACGAGAGTAGCAATGGGTT
                      ____________________________________________________________
consensus AATGCCTCTGTTGCTTTTGAAACGTGGGCACGGGAGAGGTGACGAGAGTAGCAATGGGTT
 
. : . : . : . : . : . :
JMFS147F02+ GCTCGGCTATGTTACAGTATTGAACACTCGGGGTTCCACTCGCTGTGGTGTCCATGGGCA
                      ____________________________________________________________
consensus GCTCGGCTATGTTACAGTATTGAACACTCGGGGTTCCACTCGCTGTGGTGTCCATGGGCA
 
. : . : . : . : . : . :
JMFS147F02+ CTGCTCTACTCTGCAGTGCCCTAATCGAGCAGGGGAGACGAAGATCTCAACTTGTTCTTA
                      ____________________________________________________________
consensus CTGCTCTACTCTGCAGTGCCCTAATCGAGCAGGGGAGACGAAGATCTCAACTTGTTCTTA
 
. : . : . : . : . : . :
JMFS147F02+ AACTAAAAGCTGATAGAATAACTTGCAGCTTCAATCATTAAACAGAGACCGCAAGATTCC
JMFF020O02+ CATTAAACAGAGACCGCAAGATTCC
JMFF011G07+ CATTAAACAGAGACCGCAAGATTCC
                      ____________________________________________________________
consensus AACTAAAAGCTGATAGAATAACTTGCAGCTTCAATCATTAAACAGAGACCGCAAGATTCC
 
. : . : . : . : . : . :
JMFS147F02+ TCAAAACCCATGCGAAATCTT-CCCAAAACTTTCTGCCTTTGTTTGTAAAATCACCAAAA
JMFF020O02+ TCAAAACCCATGCGAAATCTT-CCCAAAATTTTNTGCCTTTGTTTGTAAAATCACCAAAA
JMFF011G07+ TCAAAACCCATGCGAAATCTTNCCCAAAATTTTCTGCCTTTGTTTGTAAAATCACCAAAA
                      ____________________________________________________________
consensus TCAAAACCCATGCGAAATCTT-CCCAAAATTTTCTGCCTTTGTTTGTAAAATCACCAAAA
 
. : . : . : . : . : . :
JMFS147F02+ ATCTGTGCAATTCTAATCAAGCACAAGTGAGTAATAGTCAGATCAAAGGGTCAATAGAAG
JMFF020O02+ ATCTGTGCAATTCTAATCAAGCACAAGTGAGTAATAGTCAGATCAAAGGGTCAATAGAAG
JMFF011G07+ ATCTGTGCAATTCTAATCAAGCACAAGTGAGTAATAGTCAGATCAAAGGGTCAATAGAAG
                      ____________________________________________________________
consensus ATCTGTGCAATTCTAATCAAGCACAAGTGAGTAATAGTCAGATCAAAGGGTCAATAGAAG
 
. : . : . : . : . : . :
JMFS147F02+ AAAAAGAGACC-TGACAGAGAAGTTTTA
JMFF020O02+ AAAAAGAGACCNTGACAGAGAAGTTTTAGAGAGAGAGAGAGAGGAGGAGAAGTTTTATAT
JMFF011G07+ AAAAAGAGACCTTGACAGAGAAGTTTTAGAGAGAGAGAGAGAGGAGGAGAAGTTTTATAT
                      ____________________________________________________________
consensus AAAAAGAGACCTTGACAGAGAAGTTTTAGAGAGAGAGAGAGAGGAGGAGAAGTTTTATAT