Previous Contig 000589:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011D23Sequence506000589 (2)gb:AK117901_18159094e-25Arabidopsis thaliana At5g49660 mRNA for putative receptor protein kinase, comple610010246 (2)gb:AK117901_18159092e-25Arabidopsis thaliana At5g49660 mRNA for putative receptor protein kinase, comple
JMFF042L06Sequence639000589 (2)gb:AK117901_18159093e-40Arabidopsis thaliana At5g49660 mRNA for putative receptor protein kinase, comple640010246 (2)gb:AK117901_18159091e-22Arabidopsis thaliana At5g49660 mRNA for putative receptor protein kinase, comple

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042L06+ TCGCCGGTAGCCGCCACGGGCTGAACCCGCCATTCTCAT
                      ____________________________________________________________
consensus TCGCCGGTAGCCGCCACGGGCTGAACCCGCCATTCTCAT
 
. : . : . : . : . : . :
JMFF042L06+ TGAAATTGAGAACTTCAAGATTACTGAGATTAGTGACCGACAAAGGAAACTCACCGGTGA
                      ____________________________________________________________
consensus TGAAATTGAGAACTTCAAGATTACTGAGATTAGTGACCGACAAAGGAAACTCACCGGTGA
 
. : . : . : . : . : . :
JMFF042L06+ AGAGGTTGAAGGATAAATCAAGTGACCTTAAAGCCTGCAAAGGCGTCAAGTCCGGCAAAG
JMFF011D23+ CTGCAAAGGCGTCAAGTCCGGCAAAG
                      ____________________________________________________________
consensus AGAGGTTGAAGGATAAATCAAGTGACCTTAAAGCCTGCAAAGGCGTCAAGTCCGGCAAAG
 
. : . : . : . : . : . :
JMFF042L06+ CTCCGGTCACATATGTACCCGTCATGTTTAGCTCTTCCAACACCGAGCAGTTGGTGACGC
JMFF011D23+ CTCCGGTCACATATGTACCCGTCATGTTTAGCTCTTCCAACACCGAGCAGTTGGTGACGC
                      ____________________________________________________________
consensus CTCCGGTCACATATGTACCCGTCATGTTTAGCTCTTCCAACACCGAGCAGTTGGTGACGC
 
. : . : . : . : . : . :
JMFF042L06+ CGACAGGAAACCGATTTCCATGGAAATGATTCTGGCCGAGGCGAAGAACTCGCAGCTTTG
JMFF011D23+ CGACAGGAAACCGATTTCCATGGAAATGATTCTGGCCGAGGCGAAGAACTCGCAGCTTTG
                      ____________________________________________________________
consensus CGACAGGAAACCGATTTCCATGGAAATGATTCTGGCCGAGGCGAAGAACTCGCAGCTTTG
 
. : . : . : . : . : . :
JMFF042L06+ GCAAATAATCACAGACGCCTTCTGGAAACCGGCCTGATAATGACCACCCAGAAATATCGA
JMFF011D23+ GCAAATAATCACAGACGCCTTCTGGAAACCGGCCTGATAATGACCACCCAGAAATATCGA
                      ____________________________________________________________
consensus GCAAATAATCACAGACGCCTTCTGGAAACCGGCCTGATAATGACCACCCAGAAATATCGA
 
. : . : . : . : . : . :
JMFF042L06+ TCTTCACAACATAACCAAGATCATCACACCCAATCCCGGAATAGTTGCAAACATGTTTTC
JMFF011D23+ TCTTCACAACATAACCAAGATCATCACACCCAATCCCGGAATAGTTGCAAACATGTTTTC
                      ____________________________________________________________
consensus TCTTCACAACATAACCAAGATCATCACACCCAATCCCGGAATAGTTGCAAACATGTTTTC
 
. : . : . : . : . : . :
JMFF042L06+ CATCCCAGCCAGCCATCAAGTCTCCTGACAGAGACTTCTTCATAAGATCAAAGAACTCAG
JMFF011D23+ CATCCCAGCCAGCCATCAAGTCTCCTGACAGAGACTTCTTCATAAGATCAAAGAACTCAG
                      ____________________________________________________________
consensus CATCCCAGCCAGCCATCAAGTCTCCTGACAGAGACTTCTTCATAAGATCAAAGAACTCAG
 
. : . : . : . : . : . :
JMFF042L06+ ACTGGTTGTTCTTGCCCGACACAGATAATAACAACATCATCAACAAAAGAGAAAAGAACA
JMFF011D23+ ACTGGTTGTTCTTGCCCGACACAGATAATAACAACATCATCAACAAAAGAGAAAAGAACA
                      ____________________________________________________________
consensus ACTGGTTGTTCTTGCCCGACACAGATAATAACAACATCATCAACAAAAGAGAAAAGAACA
 
. : . : . : . : . : . :
JMFF042L06+ CAATCTGCTGAATTGCCATTGAGAATAGGAAAAGGAGAAAAACAAAATAATTTTTTGTTT
JMFF011D23+ CAATCTGCTGAATTGCCATTGAGAATAGGAAAAGGAGAAAAACAAAATAATTTTTTGTTT
                      ____________________________________________________________
consensus CAATCTGCTGAATTGCCATTGAGAATAGGAAAAGGAGAAAAACAAAATAATTTTTTGTTT
 
. : . : . : . : . : . :
JMFF042L06+ GACCGCAGAGTAGAGAGATATGGAGGGAGAACTGGAAGGAGAAAGTTGTGTTGGTTAAGT
JMFF011D23+ GACCGCAGAGTAGAGAGATATGGAGGGAGAACTGGAAGGAGAAAGTTGTGTTGGTTAAGT
                      ____________________________________________________________
consensus GACCGCAGAGTAGAGAGATATGGAGGGAGAACTGGAAGGAGAAAGTTGTGTTGGTTAAGT