Previous Contig 000587:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007M21Sequence479000587 (34)729000587 (34)
JMFF011D21Sequence477000587 (34)159000587 (34)
JMFF012K24Sequence181000587 (34)722000587 (34)
JMFF014F10Sequence343000587 (34)729000587 (34)
JMFF019C11Sequence476000587 (34)734000587 (34)
JMFF027J17Sequence472000587 (34)698000587 (34)
JMFF044G02Sequence510000587 (34)505000587 (34)
JMFF045A14Sequence654000587 (34)650000587 (34)
JMFF048G24Sequence328000587 (34)323000587 (34)
JMFF050H23Sequence578000587 (34)
JMFN001B12Sequence516000587 (34)
JMFN003O01Sequence594000587 (34)
JMFN004C08Sequence662000587 (34)
JMFN011B20Sequence620000587 (34)
JMFN015C10Sequence350000587 (34)
JMFN025N16Sequence652000587 (34)
JMFN036K21Sequence630000587 (34)
JMFN038J19Sequence613000587 (34)
JMFN039C18Sequence611000587 (34)
JMFN039I07Sequence625000587 (34)
JMFS011A07Sequence557000587 (34)
JMFS047G06Sequence308000587 (34)
JMFS057E04Sequence503000587 (34)
JMFS098C05Sequence621000587 (34)
JMSF029E04Sequence139000587 (34)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045A14- CCTTATGGCGGATCACCCTG
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTG
 
. : . : . : . : . : . :
rJMFF044G02- ACTAATAAATTTTATTATTTGCCAAAGCTC
JMFF044G02+ ACTAATAAATTTTATTATTTGCCAAAGCTC
JMFS057E04+ AACATAAACTAATAAATTTTATTATTTGCCAAAGCTC
rJMFF048G24- AACATAAACTAATAAATTTTATTATTTGCCAAAGCTC
JMFS047G06+ AAACTAATAAATTTTATTATTTGCCAAAGCTC
JMFN003O01- AACATAAACTAATAAATTTTATTATTTGCCAAAGCTC
JMFN015C10+ AACATAAACTAATAAATTTTATTATTTGCCAAAGCTC
rJMFF045A14- GAGAGTTTTTTTTTTTTTTTTGGAACATAAACTAATAAATTTTATTATTTGCCAAAGCTC
rJMFF012K24- AATTTTATTATTTGCCAAAGCTC
rJMFF014F10- TTTTATTATTTGCCAAAGCTC
rJMFF007M21- TTTTATTATTTGCCAAAGCTC
rJMFF019C11- ATTATTTGCC-AAGCTC
                      ____________________________________________________________
consensus GAGAGTTTTTTTTTTTTTTTTGGAACATAAACTAATAAATTTTATTATTTGCCAAAGCTC
 
. : . : . : . : . : . :
JMFN001B12+ CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
rJMFF044G02- CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
JMSF029E04+ TGACAG
JMFF044G02+ CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
JMFS057E04+ CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
rJMFF048G24- CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
JMFS047G06+ CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
JMFN003O01- CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
JMFN015C10+ CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
rJMFF045A14- CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
rJMFF012K24- CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
rJMFF014F10- CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
rJMFF007M21- CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
rJMFF027J17- CATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
rJMFF019C11- CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
                      ____________________________________________________________
consensus CATACCACATCTCATCAAACCACAGCAAACCTCATCTGATAGTGACCCAAGTGATGACAG
 
. : . : . : . : . : . :
JMFN001B12+ ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
rJMFF044G02- ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
JMSF029E04+ ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
JMFF044G02+ ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
JMFS057E04+ ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
rJMFF048G24- ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
JMFS047G06+ ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
JMFN003O01- ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
JMFN015C10+ ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
rJMFF045A14- ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
rJMFF012K24- ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
rJMFF014F10- ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
rJMFF007M21- ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
rJMFF027J17- ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
rJMFF019C11- ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
JMFN004C08+ ACTTACTTATAATAATGATAATAA
JMFN025N16+ AATAA
                      ____________________________________________________________
consensus ACATTACAAATTCTCCTTCACTATAATTCATAACATACTTACTTATAATAATGATAATAA
 
. : . : . : . : . : . :
JMFN001B12+ TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
rJMFF044G02- TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
JMSF029E04+ TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
rJMFF011D21- TAATAANAAAGCATATATAATAGCAGCANATATAAATANAACTTAACC
JMFF044G02+ TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
JMFS057E04+ TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
rJMFF048G24- TAATAATAATAATAATAAAAAAGCATATATTATAGCAGCAAATATAAATAGAACTTAACC
JMFS047G06+ TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
JMFN003O01- TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
JMFN015C10+ TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
rJMFF045A14- TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
rJMFF012K24- TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
rJMFF014F10- TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
rJMFF007M21- TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
rJMFF027J17- TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
rJMFF019C11- TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
JMFN039C18+ AATAGCAGCAAATATAAATAGAACTTAACC
JMFN004C08+ TAATAATAATAATAATAANANAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
JMFN025N16+ TAATGATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGANCTTAACN
JMFN039I07+ TAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
JMFS098C05+ GCATATATAATAGCAGCAAATATAAATAGAACTTAACC
JMFN011B20+ GCATATATAATAGCAGCAAATATAAATAGAACTTAACC
JMFN038J19+ AATAGCAGCAAATATAAATAGAACTTAACC
JMFN036K21+ AATAATAAAAAAGCATAT-TAATAGCAGCAAATATAAATAGAACTTAACC
JMFF045A14+ ATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
                      ____________________________________________________________
consensus TAATAATAATAATAATAAAAAAGCATATATAATAGCAGCAAATATAAATAGAACTTAACC
 
. : . : . : . : . : . :
JMFN001B12+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
rJMFF044G02- CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMSF029E04+ CAAC
rJMFF011D21- CNNCCCCTTCTANAAAGACCTCANNACAACCATCNACGATCAATTTACTCTGCANATTTC
JMFF044G02+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFS057E04+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
rJMFF048G24- CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFS047G06+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFN003O01- CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFN015C10+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
rJMFF045A14- CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
rJMFF012K24- CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
rJMFF014F10- CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
rJMFF007M21- CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
rJMFF027J17- CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
rJMFF019C11- CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFN039C18+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFN004C08+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFN025N16+ CAACGCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFN039I07+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFS098C05+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFN011B20+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFN038J19+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFN036K21+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFS011A07+ CAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFF050H23+ CAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
JMFF045A14+ CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATNTACTCTGCAGATTTC
                      ____________________________________________________________
consensus CAACCCCTTCTAAAAAGACCTCAGCACAACCATCCACGATCAATTTACTCTGCAGATTTC
 
. : . : . : . : . : . :
JMFN001B12+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
rJMFF044G02- TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
rJMFF011D21- TCATCANTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCA
JMFF044G02+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFS057E04+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
rJMFF048G24- TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGC
JMFS047G06+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGG
JMFN003O01- TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFN015C10+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
rJMFF045A14- TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
rJMFF012K24- TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
rJMFF014F10- TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
rJMFF007M21- TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
rJMFF027J17- TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
rJMFF019C11- TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFN039C18+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFN004C08+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFN025N16+ TCATCAGTAATTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFN039I07+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFS098C05+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFN011B20+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFN038J19+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFN036K21+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFS011A07+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFF050H23+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
JMFF045A14+ TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
                      ____________________________________________________________
consensus TCATCAGTAACTTCAGCGGCGGCGGCGGCGGGTTCCTCCGCCGCAGCCTCGGCGACTACG
 
. : . : . : . : . : . :
JMFN001B12+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
rJMFF044G02- GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFF044G02+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFS057E04+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFN003O01- GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFN015C10+ GTCTCCTCTGT
rJMFF045A14- GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
rJMFF012K24- GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
rJMFF014F10- GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
rJMFF007M21- GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
rJMFF027J17- GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
rJMFF019C11- GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFN039C18+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFN004C08+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFN025N16+ GTGTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFN039I07+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFS098C05+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFN011B20+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFN038J19+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFN036K21+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFS011A07+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFF050H23+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFF027J17+ CTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFF007M21+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFF045A14+ GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFF019C11+ TCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
JMFF011D21+ CTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
                      ____________________________________________________________
consensus GTCTCCTCTGTGGCGGCCTCGGCCGGTGGAGCCGGAGCTGCTTCCTCGGTCTTGGTTTCA
 
. : . : . : . : . : . :
JMFN001B12+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
rJMFF044G02- ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFF044G02+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFS057E04+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFN003O01- ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
rJMFF045A14- ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
rJMFF012K24- ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
rJMFF014F10- ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
rJMFF007M21- ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
rJMFF027J17- ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
rJMFF019C11- ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFN039C18+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFN004C08+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFN025N16+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFN039I07+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFS098C05+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFN011B20+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFN038J19+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFN036K21+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFS011A07+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFF050H23+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFF027J17+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFF007M21+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFF045A14+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFF019C11+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
JMFF011D21+ ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
                      ____________________________________________________________
consensus ACCTCCTCGGCTGCTACTGGCTCTGTTACCTCGGCCGCTTCTTCAACTGCGGCGGCGGCC
 
. : . : . : . : . : . :
JMFN001B12+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
rJMFF044G02- GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTT
JMFF044G02+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCT
JMFS057E04+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGG
JMFN003O01- GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
rJMFF045A14- GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
rJMFF012K24- GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
rJMFF014F10- GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
rJMFF007M21- GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
rJMFF027J17- GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
rJMFF019C11- GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFN039C18+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFN004C08+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFN025N16+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFN039I07+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFS098C05+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFN011B20+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFN038J19+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFN036K21+ GGCTCCTCCGCCTTATCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFS011A07+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFF050H23+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFF027J17+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFF014F10+ TCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFF007M21+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFF045A14+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFF019C11+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFF048G24+ CGGGTTCCGCGACGGCTTCCTTAGTCTCG
JMFF011D21+ GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
                      ____________________________________________________________
consensus GGCTCCTCCGCCTTCTCTTCTGCCGGCGCTTCGGGTTCCGCGACGGCTTCCTTAGTCTCG
 
. : . : . : . : . : . :
JMFN001B12+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCT
JMFN003O01- ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCT
rJMFF045A14- ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
rJMFF012K24- ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
rJMFF014F10- ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
rJMFF007M21- ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
rJMFF027J17- ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
rJMFF019C11- ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFN039C18+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFN004C08+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFN025N16+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFN039I07+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFS098C05+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFN011B20+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFN038J19+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFN036K21+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFS011A07+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFF050H23+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFF027J17+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFF014F10+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFF007M21+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFF045A14+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFF019C11+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFF048G24+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
JMFF011D21+ ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
                      ____________________________________________________________
consensus ACGGCGACTTCGGCAGCCGGCGTCTCCGCTTCTTCTTCGGCTGCTGGCTTCTCCGCCGCG
 
. : . : . : . : . : . :
rJMFF045A14- GGCTCTGCAAC-TTCCGGGGTTGTTTCTTC
rJMFF012K24- GGCTCTGCAACTTTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
rJMFF014F10- GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
rJMFF007M21- GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
rJMFF027J17- GGCTCTGCAACTTTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
rJMFF019C11- GGCTCTGCAACTTTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFN039C18+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFN004C08+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFN025N16+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFN039I07+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFS098C05+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFN011B20+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFN038J19+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFN036K21+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFS011A07+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFF050H23+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFF027J17+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFF014F10+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFF012K24+ TCAGGCTC
JMFF007M21+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFF045A14+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFF019C11+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFF048G24+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
JMFF011D21+ GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
                      ____________________________________________________________
consensus GGCTCTGCAAC-TTCCGGGGTTGTTTCTTCCACCGGCTTCTCCGCCACCGCCTCAGGCTC
 
. : . : . : . : . : . :
rJMFF012K24- CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
rJMFF014F10- CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
rJMFF007M21- CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
rJMFF027J17- CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
rJMFF019C11- CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFN039C18+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFN004C08+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFN025N16+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFN039I07+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFS098C05+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFN011B20+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFN038J19+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFN036K21+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFS011A07+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFF050H23+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFF027J17+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFF014F10+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFF012K24+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFF007M21+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFF045A14+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFF019C11+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFF048G24+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
JMFF011D21+ CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
                      ____________________________________________________________
consensus CGCCGCAACCGCTGGTTCCTCCGGCGCTGGCTTCACCTCAACTTCCGGCGTGACATTCTC
 
. : . : . : . : . : . :
rJMFF012K24- TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGG
rJMFF014F10- TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGG
rJMFF007M21- TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGG
rJMFF027J17- TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTG
rJMFF019C11- TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAANGTTTGAAGGA
JMFN039C18+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFN004C08+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFN025N16+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFN039I07+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFS098C05+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFN011B20+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFN038J19+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFN036K21+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGTCATTTGAAGGTTTGAAGGAGA
JMFS011A07+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFF050H23+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFF027J17+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFF014F10+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFF012K24+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFF007M21+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFF045A14+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFF019C11+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFF048G24+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
JMFF011D21+ TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
                      ____________________________________________________________
consensus TACGATCGTTGCCGGAGATGATTCAACCTCAACAGTGGCCATTTGAAGGTTTGAAGGAGA
 
. : . : . : . : . : . :
JMFN039C18+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAG
JMFN004C08+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAG
JMFN025N16+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAAC
JMFN039I07+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAA
JMFS098C05+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGC
JMFN011B20+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGG
JMFN038J19+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGC
JMFN036K21+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTG
JMFS011A07+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGC
JMFF050H23+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATTGCTTGAT
JMFF027J17+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATTGCTT
JMFF014F10+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATTGCTTGA
JMFF012K24+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATT
JMFF007M21+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATTGCTTGA
JMFF045A14+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATTGCTTGAT
JMFF019C11+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATTGCTTGAT
JMFF048G24+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATTGCATGAT
JMFF011D21+ TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATTGCTTGAT
                      ____________________________________________________________
consensus TGGGAAAAGAATAGTGCAATGGGGGCAAGCAAAGGAAAGGTGGCAACTTGATTGCTTGAT