Previous Contig 000570:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005I02Sequence446000570 (5)gb:AF191497_17754831e-38Nicotiana tabacum DnaJ-like protein mRNA, complete cds.469008385 (6)gb:AY088840_15738491e-14Arabidopsis thaliana clone 96785 mRNA, complete sequence.
JMFF006N05Sequence528000570 (5)pir|T04618|T046181e-47heat shock protein homolog F20O9.160 - Arabidopsis thaliana>gb:ATCHRIV68_1546728808008385 (6)gb:AY088840_15738492e-74Arabidopsis thaliana clone 96785 mRNA, complete sequence.
JMFF010O03Sequence573000570 (5)pir|T04618|T046188e-47heat shock protein homolog F20O9.160 - Arabidopsis thaliana>gb:ATCHRIV68_1546728770008385 (6)gb:AY088840_15738493e-77Arabidopsis thaliana clone 96785 mRNA, complete sequence.
JMFF027C21Sequence531000570 (5)pir|T04618|T046181e-47heat shock protein homolog F20O9.160 - Arabidopsis thaliana>gb:ATCHRIV68_1546728756008385 (6)gb:AY088840_15738492e-74Arabidopsis thaliana clone 96785 mRNA, complete sequence.
JMSF017O01Sequence395000570 (5)pir|T04618|T046183e-36heat shock protein homolog F20O9.160 - Arabidopsis thaliana>gb:ATCHRIV68_1546728500008385 (6)pir|T48161|T481613e-19heat shock protein 40-like - Arabidopsis thaliana>gb:ATT10O8_1554286 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF006N05+ TGCGACATTCCTAAATTGAGCAAACATATCATCCCCAAACACACCACCG
JMFF027C21+ TGCGACATTCCTAAATTGAGCAAACATATCATCCCCAAACACACCACCG
JMFF010O03+ TTGAGCAAACATATCATCCCCAAACACACCACCG
                      ____________________________________________________________
consensus TGCGACATTCCTAAATTGAGCAAACATATCATCCCCAAACACACCACCG
 
. : . : . : . : . : . :
JMFF006N05+ CGAGAAAAGTTAGTTCCGCCATGACGGGGACCCATGTCCCCCATTCCTCCAAAAGGGCTA
JMFF027C21+ CGAGAAAAGTTAGTTCCGCCATGACGGGGACCCATGTCCCCCATTCCTCCAAAAGGGCTA
JMFF005I02+ CCATGTCCCCCATTCCTCCAAAAGGGCTA
JMFF010O03+ CGAGAAAAGTTAGTTCCGCCATGACGGGGACCCATGTCCCCCATTCCTCCAAAAGGGCTA
                      ____________________________________________________________
consensus CGAGAAAAGTTAGTTCCGCCATGACGGGGACCCATGTCCCCCATTCCTCCAAAAGGGCTA
 
. : . : . : . : . : . :
JMFF006N05+ GTAAACCCAAAAAACTCGGAGAATATATCATCAGGGTTACGAGGGTTGAATCGGAA-GGA
JMFF027C21+ GTAAACCCAAAAAACTCGGAGAATATATCATCAGGGTTACGAGGGTTGAATCGGAA-GGA
JMFF005I02+ GTAAACCCAAAAAACTCGGAGAATATATCATCAGGGTTACGAGGGTTGAATCGGAA-GGA
JMSF017O01+ TCATCAGGGTTACGAGGGNTGAATCGGAANGGA
JMFF010O03+ GTAAACCCAAAAAACTCGGAGAATATATCATCAGGGTTACGAGGGTTGAATCGGAA-GGA
                      ____________________________________________________________
consensus GTAAACCCAAAAAACTCGGAGAATATATCATCAGGGTTACGAGGGTTGAATCGGAA-GGA
 
. : . : . : . : . : . :
JMFF006N05+ GGCGTGAGCAGCATCAGACGAGCTGGGAAAACCTCCGGTCCCGGGAGGTGTGAATTGACC
JMFF027C21+ GGCGTGAGCAGCATCAGACGAGCTGGGAAAACCTCCGGTCCCGGGAGGTGTGAATTGACC
JMFF005I02+ GGCGTGAGCAGCATCAGACGAGCTGGGAAAACCTCCGGTCCCGGGAGGTGTGAATTGACC
JMSF017O01+ GGCGTGAGCAGCATCAGACGAGCTGGGAAAACCTCCGGTCCCGGGAGGTGTGAATTGACC
JMFF010O03+ GGCGTGAGCAGCATCAGACGAGCTGGGAAAACCTCCGGTCCCGGGAGGTGTGAATTGACC
                      ____________________________________________________________
consensus GGCGTGAGCAGCATCAGACGAGCTGGGAAAACCTCCGGTCCCGGGAGGTGTGAATTGACC
 
. : . : . : . : . : . :
JMFF006N05+ CTTCAAACCTTCTTCCCCGTACTGATCATAAACTGCCCTCTTCTGTGGATCACTCAGCAC
JMFF027C21+ CTTCAAACCTTCTTCCCCGTACTGATCATAAACTGCCCTCTTCTGTGGATCACTCAGCAC
JMFF005I02+ CTTCAAACCTTCTTCCCCGTACTGATCATAAACTGCCCTCTTCTGTGGATCACTCAGCAC
JMSF017O01+ CTTCAAACCTTCTTCCCCGTACTGATCATAAACTGCCCTCTTCTGTGGATCACTCAGCAC
JMFF010O03+ CTTCAAACCTTCTTCCCCGTACTGATCATAAACTGCCCTCTTCTGTGGATCACTCAGCAC
                      ____________________________________________________________
consensus CTTCAAACCTTCTTCCCCGTACTGATCATAAACTGCCCTCTTCTGTGGATCACTCAGCAC
 
. : . : . : . : . : . :
JMFF006N05+ GTCGTAGGCTTCGGAGATTTGTTTGAATTTGGCTTCAGCTTCTCGCTTGTTCTTAGGGTT
JMFF027C21+ GTCGTAGGCTTCGGAGATTTGTTTGAATTTGGCTTCAGCTTCTCGCTTGTTCTTAGGGTT
JMFF005I02+ GTCGTAGGCTTCGGAGATTTGTTTGAATTTGGCTTCAGC-TCTCGCTTGTTCTTAGGGTT
JMSF017O01+ GTCGTAGGCTTCGGAGATTTGTTTGAATTTGGCTTCAGCTTCTCGCTTGTTCTTAGGGTT
JMFF010O03+ GTCGTAGGCTTCGGAGATTTGTTTGAATTTGGCTTCAGCTTCTCGCTTGTTCTTAGGGTT
                      ____________________________________________________________
consensus GTCGTAGGCTTCGGAGATTTGTTTGAATTTGGCTTCAGCTTCTCGCTTGTTCTTAGGGTT
 
. : . : . : . : . : . :
JMFF006N05+ TTTGTCAGGGTGCCACTTCATGGCGAGCTTGCGGTAAGCTTTCTTGAGATCATCGTCTTT
JMFF027C21+ TTTGTCAGGGTGCCACTTCATGGCGAGCTTGCGGTAAGCTTTCTTGAGATCATCGTCTTT
JMFF005I02+ TTTGTCAGGGTGCCACTTCATGGCGAGCTTGCGGTAAGCTTTCTTGAGATCATCGTCTTT
JMSF017O01+ TTTGTCAGGGTGCCACTTCATGGCGAGCTTGCGGTAAGCTTTCTTGAGATCATCGTCTTT
JMFF010O03+ TTTGTCAGGGTGCCACTTCATGGCGAGCTTGCGGTAAGCTTTCTTGAGATCATCGTCTTT
                      ____________________________________________________________
consensus TTTGTCAGGGTGCCACTTCATGGCGAGCTTGCGGTAAGCTTTCTTGAGATCATCGTCTTT
 
. : . : . : . : . : . :
JMFF006N05+ GGCGGTGCGGTCCACCTGAAGAATCTTGTAGTAGTCCACGCCCATTACCTTCTCCCTTTC
JMFF027C21+ GGCGGTGCGGTCCACCTGAAGAATCTTGTAGTAGTCCACGCCCATTACCTTCTCCCTTTC
JMFF005I02+ GGCGGTGCGGTCCACCTGAAGAATCTTGTAGTAGTCCACGCCCATTACCTTCTCCCTTTC
JMSF017O01+ GGCGGTGCGGTCCACCTGAAGAATCTTGTAGTAGTCCACGCCCATTACCTTCTCCCTTTC
JMFF010O03+ GGCGGTGCGGTCCACCTGAAGAATCTTGTAGTAGTCCACGCCCATTACCTTCTCCCTTTC
                      ____________________________________________________________
consensus GGCGGTGCGGTCCACCTGAAGAATCTTGTAGTAGTCCACGCCCATTACCTTCTCCCTTTC
 
. : . : . : . : . : . :
JMFF006N05+ TCTCTTCCTCCGGCTTGGCCTTGGCTTCTCCACCGTGACTTCTTTCTTATCTTTCCCC
JMFF027C21+ TCTCTTCCTCCGGCTTGGCCTTGGCTTCTCCACCGTGACTTCTTTCTTCTCTTTCCCC
JMFF005I02+ TCTCTTCCTCCGGCTTGGCCTTGGCTTCTCCACCGTGACTTCTTTCTTCTCTTTCCCC
JMSF017O01+ TCTCTTCCTCCGGCTTGGCCTTGGCTTCTCCACCGTGACTTCTTTCTTCTCTTTCCCC
JMFF010O03+ TCTCTTCCTCCGGCTTGGCCTTGGCTTCTCCACCGTGACTTCTTTCTTCTCTTTCCCCTT
                      ____________________________________________________________
consensus TCTCTTCCTCCGGCTTGGCCTTGGCTTCTCCACCGTGACTTCTTTCTTCTCTTTCCCCTT
 
. : . : . : . : . : . :
JMFF010O03+ CTTCCCTCTCACACAGCTCTTCTCTTTTTTATACATTTCACTGAACCAGGTGAACAAAAC
                      ____________________________________________________________
consensus CTTCCCTCTCACACAGCTCTTCTCTTTTTTATACATTTCACTGAACCAGGTGAACAAAAC