Previous Contig 000565:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010N13Sequence572000565 (2)
JMFF024A02Sequence457000565 (2)740021208gb:AE016959_10217792e-05Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF010N13+ TGCCTCCCCTTTTACTGCCAAACTTGTGAAAA
                      ____________________________________________________________
consensus TGCCTCCCCTTTTACTGCCAAACTTGTGAAAA
 
. : . : . : . : . : . :
JMFF010N13+ GACTGAGCAGCCGGAGGAGGAAGAGGAGGCAACCCATAAGGTCTCGGAGCGGGTCCCGAA
                      ____________________________________________________________
consensus GACTGAGCAGCCGGAGGAGGAAGAGGAGGCAACCCATAAGGTCTCGGAGCGGGTCCCGAA
 
. : . : . : . : . : . :
JMFF024A02+ GGGCCCATAGGCATCGAGCTGTGGATACCATCGATGC
JMFF010N13+ GCCAAACCCGGACCACCAACGACGGGCCCATAGGCATCGAGCTGTGGATACCATCGATGC
                      ____________________________________________________________
consensus GCCAAACCCGGACCACCAACGACGGGCCCATAGGCATCGAGCTGTGGATACCATCGATGC
 
. : . : . : . : . : . :
JMFF024A02+ CCCTGCTGCAACCCCGACGTGAGATAGGTCGCCGCCGCAGCCGCAGAGATATCCCCACTT
JMFF010N13+ CCCTGCTGCAACCCCGACGTGAGATAGGTCGCCGCCGCAGCCGCAGAGATATCCCCACTT
                      ____________________________________________________________
consensus CCCTGCTGCAACCCCGACGTGAGATAGGTCGCCGCCGCAGCCGCAGAGATATCCCCACTT
 
. : . : . : . : . : . :
JMFF024A02+ CCCTGTTGCGGCGGCGGGTGATACACATTCTCCTGAGCCTGCGCGGACAAGTCGGCGGGA
JMFF010N13+ CCCTGTTGCGGCGGCGGGTGATACACATTCTCCTGAGCCTGCGCGGACAAGTCGGCGGGA
                      ____________________________________________________________
consensus CCCTGTTGCGGCGGCGGGTGATACACATTCTCCTGAGCCTGCGCGGACAAGTCGGCGGGA
 
. : . : . : . : . : . :
JMFF024A02+ GATGCACCCGGCGGATGAATCGGCGGGGCGTGCAGCTGCCGTGGGTGATGGGCATTCGAT
JMFF010N13+ GATGCACCCGGCGGATGAATCGGCGGGGCGTGCAGCTGCCGTGGGTGATGGGCATTCGAT
                      ____________________________________________________________
consensus GATGCACCCGGCGGATGAATCGGCGGGGCGTGCAGCTGCCGTGGGTGATGGGCATTCGAT
 
. : . : . : . : . : . :
JMFF024A02+ TGATTGGGAGTGTAAGCATAGCCGTTTGGGTATTGCTGGTAATAATAGGAGTCGTAGTAA
JMFF010N13+ TGATTGGGAGTGTAAGCATAGCCGTTTGGGTATTGCTGGTAATAATAGGAGTCGTAGTAA
                      ____________________________________________________________
consensus TGATTGGGAGTGTAAGCATAGCCGTTTGGGTATTGCTGGTAATAATAGGAGTCGTAGTAA
 
. : . : . : . : . : . :
JMFF024A02+ TAGGATTGATGCTGATGATGAGGATTGTAGGCTGATGGATCATATGATTGCGATTGCGAT
JMFF010N13+ TAGGATTGATGCTGATGATGAGGATTGTAGGCTGATGGATCATATGATTGCGATTGCGAT
                      ____________________________________________________________
consensus TAGGATTGATGCTGATGATGAGGATTGTAGGCTGATGGATCATATGATTGCGATTGCGAT
 
. : . : . : . : . : . :
JMFF024A02+ TGCGATTGCCAAGATTGGTATTCTTGTCCTTGTTGATGTTGAGACGAGAGATCCATTTTT
JMFF010N13+ TGCGATTGCCAAGATTGGTATTCTTGTCCTTGTTGATGTTGAGACGAGAGATCCATTTTT
                      ____________________________________________________________
consensus TGCGATTGCCAAGATTGGTATTCTTGTCCTTGTTGATGTTGAGACGAGAGATCCATTTTT
 
. : . : . : . : . : . :
JMFF024A02+ GGGGATTTCTTCTTCTTCTTCTTCTTCTTAGCTCTACGCAGTTGATTGGACTTGGAGATC
JMFF010N13+ GGGGATTTCTTCTTCTTCTTCTTCTTCTTAGCTCTACGCAGTTGATTGGACTTGGAGATC
                      ____________________________________________________________
consensus GGGGATTTCTTCTTCTTCTTCTTCTTCTTAGCTCTACGCAGTTGATTGGACTTGGAGATC