Previous Contig 000563:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010M11Sequence584000563 (6)gb:AB082518_15241281e-50Gentiana triflora GtTIP gene for translation-inhibitor protein, complete cds.>gb
JMFF014P08Sequence586000563 (6)gb:AB082518_15241281e-50Gentiana triflora GtTIP gene for translation-inhibitor protein, complete cds.>gb
JMFF023K08Sequence345000563 (6)gb:AB082518_15241281e-10Gentiana triflora GtTIP gene for translation-inhibitor protein, complete cds.>gb
JMFF030O02Sequence385000563 (6)gb:AB082518_15241285e-17Gentiana triflora GtTIP gene for translation-inhibitor protein, complete cds.>gb318000563 (6)gb:AP004269_18395074e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P004
JMFN001H01Sequence463000563 (6)gb:AB082518_15241285e-36Gentiana triflora GtTIP gene for translation-inhibitor protein, complete cds.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF030O02- CNAATGCTTCAAAANTACTACATTCTTAAGCAGCCACCAGTCTTCAACAAGAA
                      ____________________________________________________________
consensus CNAATGCTTCAAAANTACTACATTCTTAAGCAGCCACCAGTCTTCAACAAGAA
 
. : . : . : . : . : . :
rJMFF030O02- GGTCTAGACATGTAAGCTTGGCATTATTAAATATAACAGCCCATTCCCNACAAGCTGGAT
                      ____________________________________________________________
consensus GGTCTAGACATGTAAGCTTGGCATTATTAAATATAACAGCCCATTCCCNACAAGCTGGAT
 
. : . : . : . : . : . :
rJMFF030O02- TATAGCCAAGACTTGGCATACCTGTGGGCATTGGGACTTTACAATGCTGCTATGCATTCA
                      ____________________________________________________________
consensus TATAGCCAAGACTTGGCATACCTGTGGGCATTGGGACTTTACAATGCTGCTATGCATTCA
 
. : . : . : . : . : . :
rJMFF030O02- ACTTCTATCTTTGCATCCATGGGTAATGCTGCCACCTGATAAGTTGCACGGGCTGGTGCT
JMFF014P08+ CATCCATGGGTAATGCTGCCACCTGATAAGTTGCACGGGCTGGTGCT
JMFF010M11+ TGGGTAATGCTGCCACCTGATAAGTTGCACGGGCTGGTGCT
                      ____________________________________________________________
consensus ACTTCTATCTTTGCATCCATGGGTAATGCTGCCACCTGATAAGTTGCACGGGCTGGTGCT
 
. : . : . : . : . : . :
rJMFF030O02- GGTGATGANAAATATTTANCATATATCTCATTCACTTTCTTGAAGTCCTTCAAATCAGCT
JMFF014P08+ GGTGATGAGAAATATTTAGCATATATCTCATTCACTTTCTTGAAGTCCTTCAAATCAGCT
JMFF010M11+ GGTGATGAGAAATATTTAGCATATATCTCATTCACTTTCTTGAAGTCCTTCAAATCAGCT
                      ____________________________________________________________
consensus GGTGATGAGAAATATTTAGCATATATCTCATTCACTTTCTTGAAGTCCTTCAAATCAGCT
 
. : . : . : . : . : . :
rJMFF030O02- AACAAGATTGTAGTCTTAACAACAC
JMFF014P08+ AACAAGATTGTAGTCTTAACAACACTGCTGTAGTTAGCACCACCTGCTTTGAGTATCTCC
JMFN001H01+ GTAGTCTTAACAACACTGCTGTAGTTAGCACCACCTGCTTTGAGTATCTCC
JMFF010M11+ AACAAGATTGTAGTCTTAACAACACTGCTGTAGTTAGCACCACCTGCTTTGAGTATCTCC
                      ____________________________________________________________
consensus AACAAGATTGTAGTCTTAACAACACTGCTGTAGTTAGCACCACCTGCTTTGAGTATCTCC
 
. : . : . : . : . : . :
JMFF014P08+ CCCATGTTCTTTAGAACCTGCTCTGTTTGGTCCTCCACATTATCCGACAAAAACTTCCCA
JMFN001H01+ CCCATGTTCTTTAGAACCTGCTCTGTTTGGTCCTCCACATTATCCGACAAAAACTTCCCA
JMFF030O02+ CCACATTATCCGACAAAAACTTCCCA
JMFF010M11+ CCCATGTTCTTTAGAACCTGCTCTGTTTGGTCCTCCACATTATCCGACAAAAACTTCCCA
                      ____________________________________________________________
consensus CCCATGTTCTTTAGAACCTGCTCTGTTTGGTCCTCCACATTATCCGACAAAAACTTCCCA
 
. : . : . : . : . : . :
JMFF014P08+ GTCTCTGGAACAAGACCAAGAACTCCAGATACAAAAAGAAGATTATTTGCTTTGATGGCT
JMFN001H01+ GTCTCTGGAACAAGACCAAGAACTCCAGATACAAAAAGAAGATTATTTGCTTTGATGGCT
JMFF030O02+ GTCTCTGGAACAAGACCAAGAACTCCAGATACAAAAAGAAGATTATTTGCTTTGATGGCT
JMFF023K08+ ACCAAGAACTCCAGATACAAAAAGAAGATTATTTGCTTTGATGGCT
JMFF010M11+ GTCTCTGGAACAAGACCAAGAACTCCAGATACAAAAAGAAGATTATTTGCTTTGATGGCT
                      ____________________________________________________________
consensus GTCTCTGGAACAAGACCAAGAACTCCAGATACAAAAAGAAGATTATTTGCTTTGATGGCT
 
. : . : . : . : . : . :
JMFF014P08+ TGAGAGTAAGGCCCCAGTG-AGCTGGAGCCTTTTCAGTATGAACAGCCTCCTTTCCACTT
JMFN001H01+ TGAGAGTAAGGCCCCAGTGCAGCTGGAGCCTTTTCAGTATGAACAGCCTCCTTTCCACTT
JMFF030O02+ TGAGAGTAAGGCCCCAGTG-AGCTGGAGCCTTTTCAGTATGAACAGCCTCCTTTCCACTT
JMFF023K08+ TGAGAGTAAGGCCCCAGTG-AGCTGGAGCCTTTTCAGTATGAACAGCCTCCTTTCCACTT
JMFF010M11+ TGAGAGTAAGGCCCCAGTG-AGCTGGAGCCTTTTCAGTATGAACAGCCTCCTTTCCACTT
                      ____________________________________________________________
consensus TGAGAGTAAGGCCCCAGTG-AGCTGGAGCCTTTTCAGTATGAACAGCCTCCTTTCCACTT
 
. : . : . : . : . : . :
JMFF014P08+ GTATCAGTAGAAGCGCTTAAAGAAGCGAAAGGCTTTGACGAGCGGCGAGAGGTCGCAGGC
JMFN001H01+ GTATCAGTAGAAGCGCTTAAAGAAGCGAAAGGCTTTGACGAGCGGCGAGAGGTCGCAGGC
JMFF030O02+ GTATCAGTAGAAGCGCTTAAAGAAGCGAAAGGCTTTGACGAGCGGCGAGAGGTCGCAGGC
JMFF023K08+ GTATCAGTAGAAGCGCTTAAAGAAGCGAAAGGCTTTGACGAGCGGCGAGAGGTCGCAGGC
JMFF010M11+ GTATCAGTAGAAGCGCTTAAAGAAGCGAAAGGCTTTGACGAGCGGCGAGAGGTCGCAGGC
                      ____________________________________________________________
consensus GTATCAGTAGAAGCGCTTAAAGAAGCGAAAGGCTTTGACGAGCGGCGAGAGGTCGCAGGC
 
. : . : . : . : . : . :
JMFF014P08+ AGCAGTGATACACGGCCTGCGCGGGCAAAGGCTGAGGGAGCAGGGTTGCGAAATGCGCAG
JMFN001H01+ AGCAGTGATACACGGCCTGCGCGGGCAAAGGCTGAGGGAGCAGGGTTGCGAAATGCGCAG
JMFF030O02+ AGCAGTGATACACGGCCTGCGCGGGCAAAGGCTGAGGGAGCAGGGTTGCGAAATGCGCAG
JMFF023K08+ AGCAGTGATACACGGCCTGCGCGGGCAAAGGCTGAGGGAGCAGGGTTGCGAAATGCGCAG
JMFF010M11+ AGCAGTGATACACGGCCTGCGCGGGCAAAGGCTGAGGGAGCAGGGTTGCGAAATGCGCAG
                      ____________________________________________________________
consensus AGCAGTGATACACGGCCTGCGCGGGCAAAGGCTGAGGGAGCAGGGTTGCGAAATGCGCAG
 
. : . : . : . : . : . :
JMFF014P08+ ACGTCGGAGGGGCGCAAATGGAGAGTCTTTGCTGCGGCGGACCAGGAGGCCATTGATTTC
JMFN001H01+ ACGTCGGAGGGGCGCAAATGGAGAGTCTTTGCTGCGGCGGACCAGGAGGCCATTGATTTC
JMFF030O02+ ACGTCGGAGGGGCGCAAATGGAGAGTCTTTGCTGCGGCGGACCAGGAGGCCATTGATTTC
JMFF023K08+ ACGTCGGAGGGGCGCAAATGGAGAGTCTTTGCTGCGGCGGACCAGGAGGCCATTGATTTC
JMFF010M11+ ACGTCGGAGGGGCGCAAATGGAGAGTCTTTGCTGCGGCGGACCAGGAGGCCATTGATTTC
                      ____________________________________________________________
consensus ACGTCGGAGGGGCGCAAATGGAGAGTCTTTGCTGCGGCGGACCAGGAGGCCATTGATTTC
 
. : . : . : . : . : . :
JMFF014P08+ TCCGCTTCACTCACCAAATCCCTCAACTACTGTGACGCTCAACTTCGACTGCGCTTTGCT
JMFN001H01+ TCCGCTTCACTCACCAAATCCCTCAACTACTGT-ACGCTCAACTTCGACTGCG
JMFF030O02+ TCCGCTTCACTCACCAAATCCCTCAACTACTGTGACGCTCAACTTCGACTGCGCTTTGCT
JMFF023K08+ TCCGCTTCACTCACCAAATCCCTCAACTACTGTGACGCTCAACTTCGACTGCGCTTTGCT
JMFF010M11+ TCCGCTTCACTCACCAAATCCCTCAACTACTGTGACGCTCAACTTCGACTGCGCTTTGCT
                      ____________________________________________________________
consensus TCCGCTTCACTCACCAAATCCCTCAACTACTGTGACGCTCAACTTCGACTGCGCTTTGCT