Previous Contig 000562:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010M07Sequence584000562 (4)gb:ATH252064_15521892e-12Arabidopsis thaliana partial mRNA for zfwd2 protein (zfwd2 gene).
JMFF035L02Sequence572000562 (4)gb:ATH252064_15521893e-16Arabidopsis thaliana partial mRNA for zfwd2 protein (zfwd2 gene).766010327 (3)gb:AB015478_15126404e-63Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSG15.
JMFF043J07Sequence637000562 (4)gb:ATH252064_15521895e-27Arabidopsis thaliana partial mRNA for zfwd2 protein (zfwd2 gene).612010327 (3)gb:ATH252064_15521891e-12Arabidopsis thaliana partial mRNA for zfwd2 protein (zfwd2 gene).
JMFF048J03Sequence382000562 (4)486021829

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043J07+ CAGGAATGCAAAAACCGGCAGCTA
                      ____________________________________________________________
consensus CAGGAATGCAAAAACCGGCAGCTA
 
. : . : . : . : . : . :
JMFF043J07+ TCGCCGAATTTACAGCTCCCTTGAAGCCAATACGCACAAATNTTCTCCGTNTTCGTCACA
                      ____________________________________________________________
consensus TCGCCGAATTTACAGCTCCCTTGAAGCCAATACGCACAAATNTTCTCCGTNTTCGTCACA
 
. : . : . : . : . : . :
JMFF043J07+ GCTCTAGCGTTGTTGCCGCCGCCATGAGCCGGCGTTCGACCCCAATTGTTATTAAAATTC
JMFF035L02+ GCCGCCGCCATGAGCCGGCGTTCGACCCCAATTGTTATTAAAATTC
                      ____________________________________________________________
consensus GCTCTAGCGTTGTTGCCGCCGCCATGAGCCGGCGTTCGACCCCAATTGTTATTAAAATTC
 
. : . : . : . : . : . :
JMFF043J07+ GTATTCCTCCGCGGCCCGCCCCGGTAATCATCGGAGTAGCCATGAGAGCGCTTCGACGAC
JMFF035L02+ GTATTCCTCCGCGGCCCGCCCCGGTAATCATCGGAGTAGCCATGAGAGCGCTTCGACGAC
JMFF010M07+ CCGCCCCGGTAATCATCGGAGTAGCCATGAGAGCGCTTNGACGAC
                      ____________________________________________________________
consensus GTATTCCTCCGCGGCCCGCCCCGGTAATCATCGGAGTAGCCATGAGAGCGCTTCGACGAC
 
. : . : . : . : . : . :
JMFF043J07+ GCCGTACCGTTAGTCAATGAGCCTTGTGCCTGAGGCGGCGGCGCAGCCAGTTCCCTGTGC
JMFF035L02+ GCCGTACCGTTAGTCAATGAGCCTTGTGCCTGAGGCGGCGGCGCAGCCAGTTCCCTGTGC
JMFF010M07+ GCCGTACCGTTAGTCAATGAGCCTTGTGCCTGAGGCGGCGGCGCAGCCAGTTCCCTGTGC
                      ____________________________________________________________
consensus GCCGTACCGTTAGTCAATGAGCCTTGTGCCTGAGGCGGCGGCGCAGCCAGTTCCCTGTGC
 
. : . : . : . : . : . :
JMFF043J07+ AAGAACGGGCACGGAAATCTATCGCACCGACCAGCTCGCCAATGGAAGCAAACTTTCTGC
JMFF035L02+ AAGAACGGGCACGGAAATCTATCGCACCGACCAGCTCGCCAATGGAAGCAAACTTTCTGC
JMFF010M07+ AAGAACGGGCACGGAAATCTATCGCACCGACCAGCTCGCCAATGGAAGCAAACTTTCTGC
                      ____________________________________________________________
consensus AAGAACGGGCACGGAAATCTATCGCACCGACCAGCTCGCCAATGGAAGCAAACTTTCTGC
 
. : . : . : . : . : . :
JMFF043J07+ TGCTGTTTACTACTACCGTTATCGCCTTGTGAAGGGCCAAGCCGCCGGAAAATTCGCTTG
JMFF035L02+ TGCTGTTTACTACTACCGTTATCGCCTTGTGAAGGGCCAAGCCGCCGGAAAATTCGCTTG
JMFF048J03+ AAGCCGCCGGAAAATTCGCTTG
JMFF010M07+ TGCTGTTTACTACTACCGTTATCGCCTTGTGAAGGGCCAAGCCGCCGGAAAATTCGCTTG
                      ____________________________________________________________
consensus TGCTGTTTACTACTACCGTTATCGCCTTGTGAAGGGCCAAGCCGCCGGAAAATTCGCTTG
 
. : . : . : . : . : . :
JMFF043J07+ CTTCCATCAATA-TCCATAGCCCCTAATTAAGGTTTTCTTTGTGATCACTGAATCGCAGA
JMFF035L02+ CTTCCATCAATA-TCCATAGCCCCTAATTAAGGTTTTCTTTGTGATCACTGAATCGCAGA
JMFF048J03+ GTTCCATCAATATTCCATAGCCCCTAATTAAGGTTTTCTTTGTGATCACTGAATCGCAGA
JMFF010M07+ CTTCCATCAATA-TCCATAGCCCCTAATTAAGGTTTTCTTTGTGATCACTGAATCGCAGA
                      ____________________________________________________________
consensus CTTCCATCAATA-TCCATAGCCCCTAATTAAGGTTTTCTTTGTGATCACTGAATCGCAGA
 
. : . : . : . : . : . :
JMFF043J07+ TCGCGTGAATGGATATAAAATCTGGGTTTGATCATGCGAAGACTCGATTGAGCTAAAGAT
JMFF035L02+ TCGCGTGAATGGATATAAAATCTGGGTTTGATCATGCGAAGACTCGATTGAGCTAAAGAT
JMFF048J03+ TCGCGTGAATGGATATAAAATCTGGGTTTGATCATGCGAAGACTCGATTGAGCTAAAGAT
JMFF010M07+ TCGCGTGAATGGATATAAAATCTGGGTTTGATCATGCGAAGACTCGATTGAGCTAAAGAT
                      ____________________________________________________________
consensus TCGCGTGAATGGATATAAAATCTGGGTTTGATCATGCGAAGACTCGATTGAGCTAAAGAT
 
. : . : . : . : . : . :
JMFF043J07+ TGAGATTAAAAACCAATTAATTTCAAGAAATCAAAGGATTTTAGGGTTTTCGAGACGATG
JMFF035L02+ TGAGATTAAAAACCAATTAATTTCAAGAAATCAAAGGATTTTAGGGTTTTCGAGACGATG
JMFF048J03+ TGAGATTAAAAACCAATTAATTTCAAGAAATCAAAGGATTTTAGGGTTTTCGAGACGATG
JMFF010M07+ TGAGATTAAAAACCAATTAATTTCAAGAAATCAAAGGATTTTAGGGTTTTCGAGACGATG
                      ____________________________________________________________
consensus TGAGATTAAAAACCAATTAATTTCAAGAAATCAAAGGATTTTAGGGTTTTCGAGACGATG
 
. : . : . : . : . : . :
JMFF043J07+ AAATTGAAAACCCTCCCCAAATTTCTACTTGCAAGAAAAGCGATAAGAATCCGAGAGGGA
JMFF035L02+ AAATTGAAAACCCTCCCCAAATTTCTACTTGCAAGAAAAGCGATAAGAATCCGAGAGGGA
JMFF048J03+ AAATTGAAAACCCTCCCCAAATTTCTACTTGCAAGAAAAGCGATAAGAATCCGAGAGGGA
JMFF010M07+ AAATTGAAAACCCTCCCCAAATTTCTACTTGCAAGAAAAGCGATAAGAATCCGAGAGGGA
                      ____________________________________________________________
consensus AAATTGAAAACCCTCCCCAAATTTCTACTTGCAAGAAAAGCGATAAGAATCCGAGAGGGA
 
. : . : . : . : . : . :
JMFF043J07+ AAAACAAGGGT
JMFF035L02+ AAAACAAGGGTTCCGCCGGAGGTAAGTGGATAATAGCCGGAATTAAT
JMFF048J03+ AAAACAAGGGTTCCGCCGGATGTAAGTGGATAATAGCCGGAATTAATGATTAAGGGAAAG
JMFF010M07+ AAAACAAGGGTTCCGCCGGAGGTAAGTGGATAATAGCCGGAATTAATGATTAAGGGAAAG
                      ____________________________________________________________
consensus AAAACAAGGGTTCCGCCGGAGGTAAGTGGATAATAGCCGGAATTAATGATTAAGGGAAAG
 
. : . : . : . : . : . :
JMFF048J03+ GGTGTTCAAAGAGATCTGGTTGATTTAGTACAGAACAGAAAACAGCGTAGAGTTAACGAC
JMFF010M07+ GGTGTTCAAAGAGATCTGGTTGATTTAGTACAGAACAGAAAACAGCGTAGAGTTAACGAC
                      ____________________________________________________________
consensus GGTGTTCAAAGAGATCTGGTTGATTTAGTACAGAACAGAAAACAGCGTAGAGTTAACGAC