Previous Contig 000561:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010L21Sequence578000561 (2)gb:AY251394_15927551e-33Arabidopsis thaliana WOX1 protein mRNA, complete cds.635008667 (2)
JMFF017N22Sequence580000561 (2)gb:AY251394_15927551e-33Arabidopsis thaliana WOX1 protein mRNA, complete cds.279008667 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017N22+ TCTCTGCAATAAGTGTACTAGGGGATGGCCAATTCTTGGT
JMFF010L21+ TCTGCAATAAGTGTACTAGGGGATGGCCAATTCTTGGT
                      ____________________________________________________________
consensus TCTCTGCAATAAGTGTACTAGGGGATGGCCAATTCTTGGT
 
. : . : . : . : . : . :
JMFF017N22+ GAGTTGTTGATCGGCTTCAAAACCTGTCCTATTTGCCCCTGATTCTTTTCTTTCTGTGTT
JMFF010L21+ GAGTTGTTGATCGGCTTCAAAACCTGTCCTATTTGCCCCTGATTCTTTTCTTTCTGTGTT
                      ____________________________________________________________
consensus GAGTTGTTGATCGGCTTCAAAACCTGTCCTATTTGCCCCTGATTCTTTTCTTTCTGTGTT
 
. : . : . : . : . : . :
JMFF017N22+ TTCCATGCAATTAGTGTTGTTAACGTTTGGGTGGTCATTATCGGTGGCGGCGCCACCAGC
JMFF010L21+ TTCCATGCAATTAGTGTTGTTAACGTTTGGGTGGTCATTATCGGTGGCGGCGCCACCAGC
                      ____________________________________________________________
consensus TTCCATGCAATTAGTGTTGTTAACGTTTGGGTGGTCATTATCGGTGGCGGCGCCACCAGC
 
. : . : . : . : . : . :
JMFF017N22+ TGCGGCGGACTCGAGTTGGCGGCGGCGTTTTTGGCGCTCCCGCGCTTTGTGATTCTGAAA
JMFF010L21+ TGCGGCGGACTCGAGTTGGCGGCGGCGTTTTTGGCGCTCCCGCGCTTTGTGATTCTGAAA
                      ____________________________________________________________
consensus TGCGGCGGACTCGAGTTGGCGGCGGCGTTTTTGGCGCTCCCGCGCTTTGTGATTCTGAAA
 
. : . : . : . : . : . :
JMFF017N22+ CCAGTAAAACACGTTCTTCCCTTCTATCTTCCCGTACTTGCGGAGCTGCGCGGTGATGTG
JMFF010L21+ CCAGTAAAACACGTTCTTCCCTTCTATCTTCCCGTACTTGCGGAGCTGCGCGGTGATGTG
                      ____________________________________________________________
consensus CCAGTAAAACACGTTCTTCCCTTCTATCTTCCCGTACTTGCGGAGCTGCGCGGTGATGTG
 
. : . : . : . : . : . :
JMFF017N22+ TTGGATTTGATCGGCGGACGGCGTTCTCGTTCCCCGCCGGTACAACTCCTCCAGGGTCTG
JMFF010L21+ TTGGATTTGATCGGCGGACGGCGTTCTCGTTCCCCGCCGGTACAACTCCTCCAGGGTCTG
                      ____________________________________________________________
consensus TTGGATTTGATCGGCGGACGGCGTTCTCGTTCCCCGCCGGTACAACTCCTCCAGGGTCTG
 
. : . : . : . : . : . :
JMFF017N22+ TAGCTGCTCCGGCGTCGGATTCCACCTCGAGCTCACCACAACTTGGTGCGTATTGAATTC
JMFF010L21+ TAGCTGCTCCGGCGTCGGATTCCACCTCGAGCTCACCACAACTTGGTGCGTATTGAATTC
                      ____________________________________________________________
consensus TAGCTGCTCCGGCGTCGGATTCCACCTCGAGCTCACCACAACTTGGTGCGTATTGAATTC
 
. : . : . : . : . : . :
JMFF017N22+ CCGCTTGCTTTGCTCCGCCGCCATAGCAAGATGGTGATTAAACGCGACGAAATCATTTCC
JMFF010L21+ CCGCTTGCTTTGCTCCGCCGCCATAGCAAGATGGTGATTAAACGCGACGAAATCATTTCC
                      ____________________________________________________________
consensus CCGCTTGCTTTGCTCCGCCGCCATAGCAAGATGGTGATTAAACGCGACGAAATCATTTCC
 
. : . : . : . : . : . :
JMFF017N22+ ATGGATGCGGCCTAAAGCGCAAGAAGGATTGGGAGAGGCGGCGGAGGAAGTGAGAGGACG
JMFF010L21+ ATGGATGCGGCCTAAAGCGCAAGAAGGATTGGGAGAGGCGGCGGAGGAAGTGAGAGGACG
                      ____________________________________________________________
consensus ATGGATGCGGCCTAAAGCGCAAGAAGGATTGGGAGAGGCGGCGGAGGAAGTGAGAGGACG
 
. : . : . : . : . : . :
JMFF017N22+ GGGCATGAGGGGGCGGAGGCGGCGGCTGTTGAAGGATTCCGGCATGCTGAAATCTCAACT
JMFF010L21+ GGGCATGAGGGGGCGGAGGCGGCGGCTGTTGAAGGATTCCGGCATGCTGAAATCTCAACT
                      ____________________________________________________________
consensus GGGCATGAGGGGGCGGAGGCGGCGGCTGTTGAAGGATTCCGGCATGCTGAAATCTCAACT