Previous Contig 000556:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010K20Sequence600000556 (2)gb:AC011717_15373593e-35Arabidopsis thaliana chromosome 1 BAC F19K16 genomic sequence, complete sequence713020880gb:OSJN00236_16971653e-33Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0024J22, complete seque
JMFS141H09Sequence613000556 (2)gb:AC011717_15373592e-41Arabidopsis thaliana chromosome 1 BAC F19K16 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS141H09+ CTGAGTCTGAAGCTCCAGGTTCCAGCCCAAG
                      ____________________________________________________________
consensus CTGAGTCTGAAGCTCCAGGTTCCAGCCCAAG
 
. : . : . : . : . : . :
JMFS141H09+ AATACTAAATGGCTCAAATATTTCATTCTCAGTGCTAATATTTTTTATGTAGTAAACCAG
JMFF010K20+ AATACTAAATGGCTCAAATATTTCATTCTCAGTGCTAATTTTTTTTATGTAGTAAACCAG
                      ____________________________________________________________
consensus AATACTAAATGGCTCAAATATTTCATTCTCAGTGCTAATTTTTTTTATGTAGTAAACCAG
 
. : . : . : . : . : . :
JMFS141H09+ TACACCCATTACGATCCAGAGCAGTACAACGGTAAGATTACTATAGGTTGAGAAGTTTGA
JMFF010K20+ TACACCCATTACGATCCAGAGCAGTACAACGGTAAGATTACTATAGTTTGAGAAGTTTGA
                      ____________________________________________________________
consensus TACACCCATTACGATCCAGAGCAGTACAACGGTAAGATTACTATAGTTTGAGAAGTTTGA
 
. : . : . : . : . : . :
JMFS141H09+ TATCCTCTTGAATATGGATTTCCGATACTTTCCAGACTGAAAGCAAACAGAGCATTGACA
JMFF010K20+ TATCCTCTTGAATATGGATTTCCGATACTTTCCAGACTGAAAGCAAACAGAGCATTGACA
                      ____________________________________________________________
consensus TATCCTCTTGAATATGGATTTCCGATACTTTCCAGACTGAAAGCAAACAGAGCATTGACA
 
. : . : . : . : . : . :
JMFS141H09+ GTTGATGCTGGTAGATTTTTTGGAAAAAGCACGAATTAACTTGACAATAGTGTAGGGCAC
JMFF010K20+ GTTGATGCTGGTAGATTTTTTGGAAAAAGCACGAATTAACTTGACAATAGTGTAGGGCAC
                      ____________________________________________________________
consensus GTTGATGCTGGTAGATTTTTTGGAAAAAGCACGAATTAACTTGACAATAGTGTAGGGCAC
 
. : . : . : . : . : . :
JMFS141H09+ TAATGGCAGCGCCATTATTGTCAAGATAAAGATTGGAAAAAGTGCACTATTCTCCTCCGA
JMFF010K20+ TAATGGCAGCGCCATTATTGTCAAGATAAAGATTGGAAAAAGTGCACTATTCTCCTCCGA
                      ____________________________________________________________
consensus TAATGGCAGCGCCATTATTGTCAAGATAAAGATTGGAAAAAGTGCACTATTCTCCTCCGA
 
. : . : . : . : . : . :
JMFS141H09+ TGCAGCCATAATGGATCCTCTTTAAAACTTAAAGAACTATGCTCCGGATGCCGGACGAAT
JMFF010K20+ TGCAGCCATAATGGATCCTCTTTAAAACTTAAAGAACTATGCTCCGGATGCCGGACGAAT
                      ____________________________________________________________
consensus TGCAGCCATAATGGATCCTCTTTAAAACTTAAAGAACTATGCTCCGGATGCCGGACGAAT
 
. : . : . : . : . : . :
JMFS141H09+ GGTGAACGGACGACGGTGGTGGAGCAATGGGCTGCGATGAAGAGAGAAGATGGAGCTGCT
JMFF010K20+ GGTGAACGGACGACGGTGGTGGAGCAATGGGCTGCGATGAAGAGAGAAGATGGAGCTGCT
                      ____________________________________________________________
consensus GGTGAACGGACGACGGTGGTGGAGCAATGGGCTGCGATGAAGAGAGAAGATGGAGCTGCT
 
. : . : . : . : . : . :
JMFS141H09+ GGCTGGGGCTTGGCAACGTGGGCAGTGGGCTTAAGCAGTGAGTTGAATCGACGAAGACCA
JMFF010K20+ GGCTGGGGCTTGGCAACGTGGGCAGTGGGCTTAAGCAGTGAGTTGAATCGACGAAGACCA
                      ____________________________________________________________
consensus GGCTGGGGCTTGGCAACGTGGGCAGTGGGCTTAAGCAGTGAGTTGAATCGACGAAGACCA
 
. : . : . : . : . : . :
JMFS141H09+ ACTCAGAGATGGAGGCACGGAAGAGCTTGAATCTCGAGATGTATGAGCGATTGAGCGTAG
JMFF010K20+ ACTCAGAGATGGAGGCACGGAAGAGCTTGAATCTCGAGATGTATGAGCGATTGAGCGTAG
                      ____________________________________________________________
consensus ACTCAGAGATGGAGGCACGGAAGAGCTTGAATCTCGAGATGTATGAGCGATTGAGCGTAG
 
. : . : . : . : . : . :
JMFS141H09+ CTGCGTAAGGTTGAAGACTTGGAAGACGATTGAAGGAGCCTG
JMFF010K20+ CTGCGTAAGGTTGAAGACTTGGAAGACGATTGAAGGAGCCTGGAACTAAACGCACAGTAT
                      ____________________________________________________________
consensus CTGCGTAAGGTTGAAGACTTGGAAGACGATTGAAGGAGCCTGGAACTAAACGCACAGTAT